ID: 1091220514

View in Genome Browser
Species Human (GRCh38)
Location 11:133927613-133927635
Sequence CCCCACTGTGGGGAAACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220514_1091220522 0 Left 1091220514 11:133927613-133927635 CCAGGGGTTTCCCCACAGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1091220522 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1091220514_1091220529 27 Left 1091220514 11:133927613-133927635 CCAGGGGTTTCCCCACAGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220514_1091220523 1 Left 1091220514 11:133927613-133927635 CCAGGGGTTTCCCCACAGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1091220523 11:133927637-133927659 CAGGATCCCTAAGGCCGTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 59
1091220514_1091220520 -8 Left 1091220514 11:133927613-133927635 CCAGGGGTTTCCCCACAGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1091220520 11:133927628-133927650 CAGTGGGGCCAGGATCCCTAAGG 0: 1
1: 0
2: 1
3: 21
4: 195
1091220514_1091220524 5 Left 1091220514 11:133927613-133927635 CCAGGGGTTTCCCCACAGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220514_1091220527 12 Left 1091220514 11:133927613-133927635 CCAGGGGTTTCCCCACAGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1091220527 11:133927648-133927670 AGGCCGTAAGGGTTGGAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220514 Original CRISPR CCCCACTGTGGGGAAACCCC TGG (reversed) Intronic