ID: 1091220517

View in Genome Browser
Species Human (GRCh38)
Location 11:133927623-133927645
Sequence GGGATCCTGGCCCCACTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220517_1091220529 17 Left 1091220517 11:133927623-133927645 CCCCACAGTGGGGCCAGGATCCC 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220517_1091220527 2 Left 1091220517 11:133927623-133927645 CCCCACAGTGGGGCCAGGATCCC 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1091220527 11:133927648-133927670 AGGCCGTAAGGGTTGGAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1091220517_1091220522 -10 Left 1091220517 11:133927623-133927645 CCCCACAGTGGGGCCAGGATCCC 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1091220522 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1091220517_1091220530 25 Left 1091220517 11:133927623-133927645 CCCCACAGTGGGGCCAGGATCCC 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1091220517_1091220524 -5 Left 1091220517 11:133927623-133927645 CCCCACAGTGGGGCCAGGATCCC 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220517_1091220523 -9 Left 1091220517 11:133927623-133927645 CCCCACAGTGGGGCCAGGATCCC 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1091220523 11:133927637-133927659 CAGGATCCCTAAGGCCGTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220517 Original CRISPR GGGATCCTGGCCCCACTGTG GGG (reversed) Intronic