ID: 1091220518

View in Genome Browser
Species Human (GRCh38)
Location 11:133927624-133927646
Sequence AGGGATCCTGGCCCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220518_1091220530 24 Left 1091220518 11:133927624-133927646 CCCACAGTGGGGCCAGGATCCCT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1091220518_1091220523 -10 Left 1091220518 11:133927624-133927646 CCCACAGTGGGGCCAGGATCCCT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1091220523 11:133927637-133927659 CAGGATCCCTAAGGCCGTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 59
1091220518_1091220524 -6 Left 1091220518 11:133927624-133927646 CCCACAGTGGGGCCAGGATCCCT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220518_1091220527 1 Left 1091220518 11:133927624-133927646 CCCACAGTGGGGCCAGGATCCCT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1091220527 11:133927648-133927670 AGGCCGTAAGGGTTGGAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1091220518_1091220529 16 Left 1091220518 11:133927624-133927646 CCCACAGTGGGGCCAGGATCCCT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220518 Original CRISPR AGGGATCCTGGCCCCACTGT GGG (reversed) Intronic