ID: 1091220519

View in Genome Browser
Species Human (GRCh38)
Location 11:133927625-133927647
Sequence TAGGGATCCTGGCCCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220519_1091220524 -7 Left 1091220519 11:133927625-133927647 CCACAGTGGGGCCAGGATCCCTA 0: 1
1: 0
2: 2
3: 13
4: 224
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220519_1091220531 30 Left 1091220519 11:133927625-133927647 CCACAGTGGGGCCAGGATCCCTA 0: 1
1: 0
2: 2
3: 13
4: 224
Right 1091220531 11:133927678-133927700 ATGCATGGAGAGTAGGAAGACGG 0: 1
1: 0
2: 3
3: 48
4: 568
1091220519_1091220527 0 Left 1091220519 11:133927625-133927647 CCACAGTGGGGCCAGGATCCCTA 0: 1
1: 0
2: 2
3: 13
4: 224
Right 1091220527 11:133927648-133927670 AGGCCGTAAGGGTTGGAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1091220519_1091220529 15 Left 1091220519 11:133927625-133927647 CCACAGTGGGGCCAGGATCCCTA 0: 1
1: 0
2: 2
3: 13
4: 224
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220519_1091220530 23 Left 1091220519 11:133927625-133927647 CCACAGTGGGGCCAGGATCCCTA 0: 1
1: 0
2: 2
3: 13
4: 224
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220519 Original CRISPR TAGGGATCCTGGCCCCACTG TGG (reversed) Intronic