ID: 1091220521

View in Genome Browser
Species Human (GRCh38)
Location 11:133927636-133927658
Sequence CCTTACGGCCTTAGGGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 42}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220521_1091220531 19 Left 1091220521 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1091220531 11:133927678-133927700 ATGCATGGAGAGTAGGAAGACGG 0: 1
1: 0
2: 3
3: 48
4: 568
1091220521_1091220530 12 Left 1091220521 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1091220521_1091220529 4 Left 1091220521 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220521_1091220533 26 Left 1091220521 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1091220533 11:133927685-133927707 GAGAGTAGGAAGACGGGCCGAGG 0: 1
1: 0
2: 3
3: 10
4: 157
1091220521_1091220534 27 Left 1091220521 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1091220534 11:133927686-133927708 AGAGTAGGAAGACGGGCCGAGGG 0: 1
1: 0
2: 0
3: 12
4: 124
1091220521_1091220532 20 Left 1091220521 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1091220532 11:133927679-133927701 TGCATGGAGAGTAGGAAGACGGG 0: 1
1: 0
2: 0
3: 23
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220521 Original CRISPR CCTTACGGCCTTAGGGATCC TGG (reversed) Intronic