ID: 1091220524

View in Genome Browser
Species Human (GRCh38)
Location 11:133927641-133927663
Sequence ATCCCTAAGGCCGTAAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 38}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220514_1091220524 5 Left 1091220514 11:133927613-133927635 CCAGGGGTTTCCCCACAGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220511_1091220524 14 Left 1091220511 11:133927604-133927626 CCATAATGACCAGGGGTTTCCCC 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220517_1091220524 -5 Left 1091220517 11:133927623-133927645 CCCCACAGTGGGGCCAGGATCCC 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220518_1091220524 -6 Left 1091220518 11:133927624-133927646 CCCACAGTGGGGCCAGGATCCCT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220519_1091220524 -7 Left 1091220519 11:133927625-133927647 CCACAGTGGGGCCAGGATCCCTA 0: 1
1: 0
2: 2
3: 13
4: 224
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220507_1091220524 27 Left 1091220507 11:133927591-133927613 CCAGGGTATAAGACCATAATGAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220524 Original CRISPR ATCCCTAAGGCCGTAAGGGT TGG Intronic