ID: 1091220525

View in Genome Browser
Species Human (GRCh38)
Location 11:133927643-133927665
Sequence TTCCAACCCTTACGGCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 43}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220525_1091220534 20 Left 1091220525 11:133927643-133927665 CCCTAAGGCCGTAAGGGTTGGAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1091220534 11:133927686-133927708 AGAGTAGGAAGACGGGCCGAGGG 0: 1
1: 0
2: 0
3: 12
4: 124
1091220525_1091220532 13 Left 1091220525 11:133927643-133927665 CCCTAAGGCCGTAAGGGTTGGAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1091220532 11:133927679-133927701 TGCATGGAGAGTAGGAAGACGGG 0: 1
1: 0
2: 0
3: 23
4: 307
1091220525_1091220530 5 Left 1091220525 11:133927643-133927665 CCCTAAGGCCGTAAGGGTTGGAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1091220525_1091220529 -3 Left 1091220525 11:133927643-133927665 CCCTAAGGCCGTAAGGGTTGGAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220525_1091220533 19 Left 1091220525 11:133927643-133927665 CCCTAAGGCCGTAAGGGTTGGAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1091220533 11:133927685-133927707 GAGAGTAGGAAGACGGGCCGAGG 0: 1
1: 0
2: 3
3: 10
4: 157
1091220525_1091220531 12 Left 1091220525 11:133927643-133927665 CCCTAAGGCCGTAAGGGTTGGAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1091220531 11:133927678-133927700 ATGCATGGAGAGTAGGAAGACGG 0: 1
1: 0
2: 3
3: 48
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220525 Original CRISPR TTCCAACCCTTACGGCCTTA GGG (reversed) Intronic