ID: 1091220529

View in Genome Browser
Species Human (GRCh38)
Location 11:133927663-133927685
Sequence GAAGAAGGTCACGCTATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220525_1091220529 -3 Left 1091220525 11:133927643-133927665 CCCTAAGGCCGTAAGGGTTGGAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220521_1091220529 4 Left 1091220521 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220518_1091220529 16 Left 1091220518 11:133927624-133927646 CCCACAGTGGGGCCAGGATCCCT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220519_1091220529 15 Left 1091220519 11:133927625-133927647 CCACAGTGGGGCCAGGATCCCTA 0: 1
1: 0
2: 2
3: 13
4: 224
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220526_1091220529 -4 Left 1091220526 11:133927644-133927666 CCTAAGGCCGTAAGGGTTGGAAG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220514_1091220529 27 Left 1091220514 11:133927613-133927635 CCAGGGGTTTCCCCACAGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68
1091220517_1091220529 17 Left 1091220517 11:133927623-133927645 CCCCACAGTGGGGCCAGGATCCC 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1091220529 11:133927663-133927685 GAAGAAGGTCACGCTATGCATGG 0: 1
1: 0
2: 1
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220529 Original CRISPR GAAGAAGGTCACGCTATGCA TGG Intronic