ID: 1091220530

View in Genome Browser
Species Human (GRCh38)
Location 11:133927671-133927693
Sequence TCACGCTATGCATGGAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220528_1091220530 -3 Left 1091220528 11:133927651-133927673 CCGTAAGGGTTGGAAGAAGGTCA 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1091220519_1091220530 23 Left 1091220519 11:133927625-133927647 CCACAGTGGGGCCAGGATCCCTA 0: 1
1: 0
2: 2
3: 13
4: 224
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1091220521_1091220530 12 Left 1091220521 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1091220518_1091220530 24 Left 1091220518 11:133927624-133927646 CCCACAGTGGGGCCAGGATCCCT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1091220526_1091220530 4 Left 1091220526 11:133927644-133927666 CCTAAGGCCGTAAGGGTTGGAAG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1091220525_1091220530 5 Left 1091220525 11:133927643-133927665 CCCTAAGGCCGTAAGGGTTGGAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1091220517_1091220530 25 Left 1091220517 11:133927623-133927645 CCCCACAGTGGGGCCAGGATCCC 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1091220530 11:133927671-133927693 TCACGCTATGCATGGAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220530 Original CRISPR TCACGCTATGCATGGAGAGT AGG Intronic