ID: 1091220533

View in Genome Browser
Species Human (GRCh38)
Location 11:133927685-133927707
Sequence GAGAGTAGGAAGACGGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220521_1091220533 26 Left 1091220521 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1091220533 11:133927685-133927707 GAGAGTAGGAAGACGGGCCGAGG 0: 1
1: 0
2: 3
3: 10
4: 157
1091220525_1091220533 19 Left 1091220525 11:133927643-133927665 CCCTAAGGCCGTAAGGGTTGGAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1091220533 11:133927685-133927707 GAGAGTAGGAAGACGGGCCGAGG 0: 1
1: 0
2: 3
3: 10
4: 157
1091220528_1091220533 11 Left 1091220528 11:133927651-133927673 CCGTAAGGGTTGGAAGAAGGTCA 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1091220533 11:133927685-133927707 GAGAGTAGGAAGACGGGCCGAGG 0: 1
1: 0
2: 3
3: 10
4: 157
1091220526_1091220533 18 Left 1091220526 11:133927644-133927666 CCTAAGGCCGTAAGGGTTGGAAG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1091220533 11:133927685-133927707 GAGAGTAGGAAGACGGGCCGAGG 0: 1
1: 0
2: 3
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220533 Original CRISPR GAGAGTAGGAAGACGGGCCG AGG Intronic