ID: 1091220758

View in Genome Browser
Species Human (GRCh38)
Location 11:133928673-133928695
Sequence CTCAAACAGGAGTGTAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 201}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220752_1091220758 7 Left 1091220752 11:133928643-133928665 CCGGGGCAGGGCAGGTGGCTGCC 0: 1
1: 0
2: 13
3: 86
4: 650
Right 1091220758 11:133928673-133928695 CTCAAACAGGAGTGTAGGGAGGG 0: 1
1: 0
2: 2
3: 10
4: 201
1091220740_1091220758 28 Left 1091220740 11:133928622-133928644 CCCAGCTCAAGGTTGTCACCCCC 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1091220758 11:133928673-133928695 CTCAAACAGGAGTGTAGGGAGGG 0: 1
1: 0
2: 2
3: 10
4: 201
1091220751_1091220758 8 Left 1091220751 11:133928642-133928664 CCCGGGGCAGGGCAGGTGGCTGC 0: 1
1: 0
2: 9
3: 116
4: 694
Right 1091220758 11:133928673-133928695 CTCAAACAGGAGTGTAGGGAGGG 0: 1
1: 0
2: 2
3: 10
4: 201
1091220750_1091220758 9 Left 1091220750 11:133928641-133928663 CCCCGGGGCAGGGCAGGTGGCTG 0: 1
1: 1
2: 8
3: 77
4: 536
Right 1091220758 11:133928673-133928695 CTCAAACAGGAGTGTAGGGAGGG 0: 1
1: 0
2: 2
3: 10
4: 201
1091220741_1091220758 27 Left 1091220741 11:133928623-133928645 CCAGCTCAAGGTTGTCACCCCCG 0: 1
1: 0
2: 1
3: 7
4: 52
Right 1091220758 11:133928673-133928695 CTCAAACAGGAGTGTAGGGAGGG 0: 1
1: 0
2: 2
3: 10
4: 201
1091220749_1091220758 10 Left 1091220749 11:133928640-133928662 CCCCCGGGGCAGGGCAGGTGGCT 0: 1
1: 0
2: 5
3: 55
4: 485
Right 1091220758 11:133928673-133928695 CTCAAACAGGAGTGTAGGGAGGG 0: 1
1: 0
2: 2
3: 10
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220758 Original CRISPR CTCAAACAGGAGTGTAGGGA GGG Intronic
901554568 1:10021498-10021520 CTGAAACTGGATTGTAGGAATGG - Intergenic
901934401 1:12617692-12617714 CTGACAGAGGAGTTTAGGGAGGG + Exonic
902368279 1:15991000-15991022 GTCCACCAGGAGTGCAGGGAGGG + Intergenic
904939913 1:34158461-34158483 TTCATCCAGGAGGGTAGGGAGGG - Intronic
906717334 1:47979895-47979917 CTCAAGCAAGAGGGTTGGGAAGG + Intronic
908149540 1:61285657-61285679 CTCAAATAGGGGTGGAGGGTAGG + Intronic
910506155 1:87952068-87952090 CTCACACAGGAGAGTAAGGCAGG + Intergenic
910587408 1:88894737-88894759 CTAAAACAGGATTGCGGGGATGG - Intergenic
910877420 1:91890128-91890150 TTCAAACAGGATTGTAAGCAGGG + Intronic
913476938 1:119246579-119246601 CTCTAACAGGGGTGGAAGGAGGG + Intergenic
914898216 1:151695900-151695922 CTTAAACAGCAGTGATGGGAAGG + Exonic
919363748 1:196630483-196630505 ATCCAACAAGAGTGGAGGGAGGG + Intergenic
1063007716 10:1989747-1989769 ATCAGACAGGAGTCCAGGGAAGG + Intergenic
1063906672 10:10786912-10786934 CACACACAGGAGTGCAGGGAAGG + Intergenic
1064344572 10:14520286-14520308 CTCCAAGAGGAGAGTGGGGAAGG - Exonic
1067828508 10:49596643-49596665 ATAAAACAGGGCTGTAGGGAAGG + Intergenic
1069344736 10:67455467-67455489 TCCAAACAGGAGAGTAGGAAGGG + Intronic
1070650762 10:78234077-78234099 CTGACACAGGAGAGGAGGGAAGG - Intergenic
1071864334 10:89709843-89709865 TTTAAACAGTAGTGTTGGGATGG + Intronic
1073013190 10:100377613-100377635 CTCAATCAGTAGAGAAGGGAAGG + Intergenic
1073469081 10:103711693-103711715 CTCACACAGGAGCAGAGGGAAGG + Intronic
1076809214 10:132878145-132878167 CTCATCCAGGAGTGGAGGGTGGG - Intronic
1078333502 11:10445357-10445379 CTCAAACTGGAGTGGAGGGGTGG + Intronic
1081199759 11:40201883-40201905 TTCAAACTGGTGTGTAGTGAGGG - Intronic
1081668106 11:44928198-44928220 CTCAGACAGGTGTTCAGGGATGG + Intronic
1082072690 11:47951647-47951669 CTCAAACAAGAGTGTTGCAATGG - Intergenic
1084095868 11:66910880-66910902 CTCAAACTGCAGTGCTGGGAGGG - Intronic
1084489611 11:69471230-69471252 CTCAAACCCCAGGGTAGGGAAGG + Intergenic
1084665199 11:70572519-70572541 CTCAGACAGAAGGGAAGGGAAGG + Intronic
1086573822 11:88315213-88315235 CTCAAACAGCAGAGGTGGGAGGG - Intronic
1087078030 11:94143789-94143811 CCCAGACTGGAGTGTAGTGATGG + Intronic
1087919095 11:103845909-103845931 CTCAACTACCAGTGTAGGGAGGG + Intergenic
1088153478 11:106776412-106776434 CTCAAACTAGATTGTTGGGAGGG + Intronic
1090104579 11:123838781-123838803 CTCTAAAAAGAGTGTAGGAATGG - Intergenic
1090407126 11:126483156-126483178 CTCAAAGAGGAATGCAGGCAAGG + Intronic
1091220758 11:133928673-133928695 CTCAAACAGGAGTGTAGGGAGGG + Intronic
1092003664 12:5051100-5051122 CTCAGGAAGGAGTGTAGGTAGGG - Intergenic
1092917524 12:13202154-13202176 CCCAAACAAGAGTGGAAGGATGG - Intronic
1092982440 12:13810101-13810123 TTTAAACAGGATGGTAGGGAAGG - Intronic
1097499562 12:60385470-60385492 CTGAAACAGGATTGTAGTAATGG - Intergenic
1099749482 12:86754323-86754345 AGCAAGCAGGAGTGAAGGGAGGG + Intronic
1102907542 12:116688307-116688329 CTCAACCAGGATTCTAGGGGTGG + Intergenic
1103555669 12:121764925-121764947 CTCTGACAGGAGAGCAGGGATGG + Intronic
1104372603 12:128237107-128237129 CTCTGAAAGGAGGGTAGGGAGGG - Intergenic
1106226241 13:27789430-27789452 CTCAAATTGGAGGGTGGGGAGGG - Intergenic
1108594513 13:51938000-51938022 GTGAAGCAGGAGAGTAGGGAGGG - Intronic
1110701513 13:78554130-78554152 TTCACACATGAGAGTAGGGATGG + Intergenic
1110895883 13:80752206-80752228 CTCTGACAGAAGTTTAGGGAAGG - Intergenic
1112444925 13:99455266-99455288 CTCAAATAGGATTGTGGTGATGG + Intergenic
1112469020 13:99671172-99671194 CTAAAATAGGATGGTAGGGAAGG - Intronic
1112561293 13:100517133-100517155 TCCAAACCGGAGTGGAGGGAGGG + Intronic
1113954692 13:114091536-114091558 CTCATCCAGGAATGCAGGGATGG - Intronic
1117049571 14:51846828-51846850 CTCACACAAAAGTGGAGGGAAGG - Intronic
1119310894 14:73645271-73645293 CTCAGACAGGAGAAAAGGGAGGG + Intronic
1119665848 14:76484505-76484527 CTGGAACAGGAGTGTGGGGCGGG - Intronic
1121814943 14:96921993-96922015 CTGAAGCAGGAGTGCAGAGAAGG - Intronic
1122768549 14:104086812-104086834 CACAAGCAGGAGTGTGGGGAGGG - Intronic
1129525222 15:76209324-76209346 CACAGACAGGAGTGTTGGGATGG + Intronic
1130016733 15:80193236-80193258 CGCAAACAGCAGGGCAGGGAAGG - Intergenic
1132206387 15:99988808-99988830 CCCAAACAGCAGAGGAGGGAAGG + Intronic
1132377998 15:101344514-101344536 CTCCAGCAGGAGAGGAGGGAGGG - Intronic
1134824610 16:17274569-17274591 ACCAAAAGGGAGTGTAGGGATGG + Intronic
1135121200 16:19767810-19767832 CTGATACAGGAGTGCTGGGAAGG - Intronic
1139859967 16:70012789-70012811 CTGATACAGGAGTGCTGGGAAGG + Intergenic
1140740729 16:77938915-77938937 GGGAAACAGGAGTGTGGGGATGG + Intronic
1142260668 16:89041169-89041191 CTCAAACAGGAGGGGAGGGAAGG - Intergenic
1143186141 17:5011620-5011642 CTGACACTGCAGTGTAGGGAGGG + Intronic
1143249366 17:5511492-5511514 CACAAACAAGTGTGTGGGGATGG - Intronic
1143845931 17:9772654-9772676 CTGAAACATGAGTCTGGGGATGG - Intronic
1146042110 17:29465608-29465630 CTAAAACTGGATTGTAGTGATGG - Intronic
1146372025 17:32270631-32270653 CTCAAGCAGGAGTGTTAGCAGGG + Intronic
1147905436 17:43819469-43819491 CTCATCCAGGAATGCAGGGAAGG - Intronic
1148889781 17:50799392-50799414 GTCATACTGGAGTGTAGGGTGGG - Intergenic
1148921059 17:51034604-51034626 TTCAAACTGGACTGGAGGGAAGG + Intronic
1149200377 17:54178722-54178744 CTCAAACATGACAGTAGTGATGG - Intergenic
1150882204 17:69042892-69042914 CACAAACAGGAGTGGGGAGATGG + Intronic
1153695215 18:7633530-7633552 TTCCAAGAGGAGTGAAGGGAAGG - Intronic
1158275198 18:55759292-55759314 GTCAAAGAAGAGTGTAGGGTTGG + Intergenic
1159248808 18:65846705-65846727 CACAAACAGCAGTGCTGGGAAGG - Intronic
1160907738 19:1459759-1459781 CACAGACAGGGCTGTAGGGATGG - Intronic
1163493866 19:17633268-17633290 CCCACAGAGGAGTGTAGGGTAGG + Intronic
1163523096 19:17803641-17803663 CTTGAACAGGAGTGCAGGGTAGG + Intronic
1166073149 19:40398171-40398193 AGTCAACAGGAGTGTAGGGACGG + Intronic
1167270656 19:48503865-48503887 CTCAAAGAGGAAGGAAGGGAGGG - Intronic
1167697310 19:51022874-51022896 CTCAAAAACGAGTTTGGGGATGG + Intronic
1168100651 19:54139212-54139234 CTCAGGCAGGGGTGAAGGGAGGG - Intronic
1168116548 19:54224097-54224119 TTCAGACAGGAGGGTGGGGACGG + Intronic
1168119531 19:54243883-54243905 TTCAGACAGGAGGGTGGGGACGG + Intronic
1168168692 19:54572545-54572567 TTCAGACAGGAGGGTGGGGACGG - Intergenic
925414721 2:3661369-3661391 CTCAAGCAGGGGTTCAGGGAAGG + Intronic
925716075 2:6785648-6785670 TTCACACAGGACTGTGGGGAGGG - Intergenic
925913597 2:8588664-8588686 CTCATACAGGAGGGGAAGGAAGG + Intergenic
925930771 2:8706111-8706133 CTCAAACAATAATTTAGGGAAGG + Intergenic
926672768 2:15591392-15591414 ATCAAACATGGGTGAAGGGAGGG + Intronic
927149718 2:20188593-20188615 CACATACAGGATTGTAGTGAGGG - Intergenic
928697881 2:33868557-33868579 CTAAAACAGGATTGTTGTGATGG - Intergenic
929277368 2:40040977-40040999 ATTAAACAGAAGTGTTGGGAGGG - Intergenic
930305811 2:49673292-49673314 CCCAAACTGGAGTGCAGTGATGG + Intergenic
931233939 2:60397845-60397867 CTAAAACAAGAGTGTAGGGAAGG - Intergenic
932036204 2:68249688-68249710 CTCAAATAAGGGTGAAGGGAGGG + Intronic
932582953 2:73004485-73004507 TCCAAACAGGAGTTTAGGAAGGG + Intronic
941431306 2:165417558-165417580 CTCACACAGGTGTACAGGGAAGG - Intergenic
941782810 2:169463165-169463187 CTCAAAAAGGAGAATAGTGAAGG + Intergenic
942911340 2:181247668-181247690 CTCAAACCAGAGTCAAGGGAAGG + Intergenic
944050200 2:195459418-195459440 ATCAAACAGTAGAGTAGGAAAGG - Intergenic
944308978 2:198211059-198211081 ATCAAGCAGGAGAGGAGGGAGGG - Intronic
947048501 2:226016513-226016535 CAGAAACAGGAATGAAGGGAAGG - Intergenic
948134661 2:235627725-235627747 CTCAAACAGGAGTATTGCAATGG - Intronic
948900265 2:240953117-240953139 GTCAAACAGGAGTGCAGGCTTGG + Intronic
1168755271 20:312390-312412 CTCAAAAAGGAAGGGAGGGAGGG - Intergenic
1170025982 20:11890688-11890710 CTCAAGCAGGAGTGAGGGGTGGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171227045 20:23450695-23450717 GTCAAATAGGATTGTAGGGGTGG - Intronic
1172005285 20:31815393-31815415 CTCAAACAGGAGCAGAGGGAAGG + Intergenic
1172764046 20:37341663-37341685 CTCACACAGGAGTGTGTGCATGG - Intergenic
1173861594 20:46287466-46287488 CTCAGACTGGAGTGTGGGGGTGG + Intronic
1175966414 20:62662112-62662134 CTCAACCAGGATAGGAGGGAAGG + Intronic
1176993280 21:15523558-15523580 CTGATACAGGAGTGCTGGGAAGG + Intergenic
1183003317 22:34879637-34879659 CTCCAACTGGAGTCTAGGGTGGG + Intergenic
1183128912 22:35813885-35813907 ATCAAACTGGAGTGCAGGGATGG + Intronic
1184279574 22:43429308-43429330 CTCAGCCTGGAGTGCAGGGAGGG + Intronic
1184519060 22:44981676-44981698 CTCAGAAAGGAGGGGAGGGAGGG + Intronic
951522602 3:23623388-23623410 CTAAAACTGGATTGTAGTGATGG + Intergenic
952134295 3:30399648-30399670 CTCAAACAGAAGGGAAGGGGAGG + Intergenic
953346164 3:42177824-42177846 ATCAAACAGGAGTGGATGGCAGG - Intronic
954671803 3:52295027-52295049 TACAAACAGAAGTATAGGGAAGG - Intergenic
954915583 3:54146574-54146596 CTGACACAGGAATGTGGGGAAGG + Intronic
956797378 3:72729031-72729053 CCCAACCTGGAGTGGAGGGAGGG - Intergenic
961616123 3:128182624-128182646 CTCGAACAGTAGTGTCTGGAAGG + Intronic
961820843 3:129574953-129574975 CCCAAAGAGGAGGGCAGGGAGGG + Intronic
962502650 3:136010720-136010742 CTTAGACAGGAGTTTGGGGATGG - Intronic
964520512 3:157562009-157562031 AACAAACAGTAGTGTAGAGAAGG - Intronic
965532904 3:169792680-169792702 CTCAAGCAGCAGTGTAGGTCAGG + Intergenic
965994400 3:174862292-174862314 CTGTAACAGGAGTAGAGGGAGGG + Intronic
966897670 3:184457842-184457864 CTAATACAGGAGTGAAGGAAGGG - Intronic
969345538 4:6567586-6567608 CTCCATCAGGAGGGTAGGGTAGG - Intergenic
969573029 4:8021315-8021337 CCCAAACAGGTGTGGGGGGAGGG - Intronic
972029540 4:34436302-34436324 CTAAAAGAGGGGTGGAGGGAAGG + Intergenic
972146782 4:36037653-36037675 CTAGAACAGGACTGGAGGGAGGG + Intronic
972671779 4:41219416-41219438 CTGAAATAGGAGTGGAAGGAAGG - Intergenic
973829945 4:54748390-54748412 CTCAAACAGGAAGATATGGAAGG + Intergenic
974034048 4:56801920-56801942 CTCAACTAGGAGTTTAGAGAGGG + Intergenic
979484650 4:121256742-121256764 CTCAAACAGAAGAAAAGGGATGG - Intergenic
982558614 4:156900832-156900854 CTCAAAAAGGAATGAAAGGAAGG + Intronic
985015875 4:185635430-185635452 CAGAAGCAGAAGTGTAGGGATGG + Intronic
985241145 4:187932111-187932133 CTCATACTGGTGTGTAGGGGTGG + Intergenic
986018072 5:3775241-3775263 CTCACACAGGAGTGAGGGGCCGG + Intergenic
988163648 5:27553360-27553382 GTCAAAAAGGAGAGTTGGGAGGG + Intergenic
988636970 5:32995247-32995269 CTCAAACAGTTGTATAGGGCCGG - Intergenic
988727590 5:33939387-33939409 CTCAAACAGAGGTGTGGGGTAGG + Intergenic
989347390 5:40445246-40445268 CTCAAAGCTGAGTGTATGGAAGG + Intergenic
990326233 5:54678343-54678365 TTAAACCAGGTGTGTAGGGAAGG + Intergenic
991127952 5:63088693-63088715 CTTAAACAGGAGACTAGAGAGGG - Intergenic
993032262 5:82718312-82718334 CCTAAACATGAGTGAAGGGAAGG + Intergenic
994885064 5:105549492-105549514 CTGATACAGGAGTGCTGGGAAGG - Intergenic
995654914 5:114414898-114414920 CTAAAACTGGATTGTAGTGATGG - Intronic
995716533 5:115086478-115086500 ATAAGACAGGAGTGAAGGGAAGG + Intergenic
995804873 5:116040277-116040299 ATATAACAGGAGTGAAGGGAAGG - Intronic
995804886 5:116040400-116040422 ATATAACAGGAGTGAAGGGAAGG + Intronic
997488237 5:134250012-134250034 TTCAAAAAGAAGTGTAGAGAGGG - Intergenic
999175568 5:149629470-149629492 CTCAAACAGGAAGGGAGAGAGGG + Intronic
999652648 5:153782817-153782839 ACCATACAGGAGTGAAGGGAAGG + Intronic
1000530823 5:162417634-162417656 CTAAAGCAGGAGGGTAGGAAGGG - Intergenic
1003125431 6:3351946-3351968 ACCAAACAGGAGAGCAGGGAGGG + Intronic
1004435240 6:15586052-15586074 CTCAAAATGGAGGGGAGGGAAGG + Intronic
1005167359 6:22939517-22939539 CTCAAACAACTGTGTGGGGAGGG + Intergenic
1005860079 6:29893592-29893614 CTCAGGCTGGAGTGTAGGGGCGG - Intergenic
1009896776 6:69761723-69761745 CTAAAACTGGATTGTAGTGATGG - Intronic
1011986557 6:93454658-93454680 CTCAAACAGCAGGGTAGAGAAGG - Intergenic
1013227074 6:108127520-108127542 CACAGACAGGTGTGGAGGGATGG + Intronic
1017274549 6:152550898-152550920 ATCACACAGAAGTGCAGGGATGG + Intronic
1018567238 6:165167656-165167678 CTCAGACAGGATTGGAGGAAAGG + Intergenic
1022726875 7:32989261-32989283 CTAAAACAGGATTATAGTGATGG - Intronic
1023522091 7:41059154-41059176 CTCCAGCAGGAGAGTAGGGGAGG - Intergenic
1024550906 7:50561673-50561695 ATCAACCAGGAGTGGGGGGAGGG - Intronic
1025046710 7:55698373-55698395 CTAAAACAGGATTATAGTGATGG + Intergenic
1025807174 7:64845081-64845103 CTCAGAGAGGAGTGTTGGGAAGG - Intergenic
1027533139 7:79361280-79361302 CTGATACAGGAGTGCTGGGAAGG + Intronic
1028679949 7:93515564-93515586 ATCAAACAAGAGTGTAGCAAAGG - Intronic
1028682781 7:93556160-93556182 TTAAAACAGTAGAGTAGGGATGG + Intronic
1030698518 7:112613173-112613195 CACAAACAGAAGTATAGAGAAGG + Intergenic
1032475314 7:132207795-132207817 CTCAAAGAGGATTGTGTGGAAGG - Intronic
1032544904 7:132733944-132733966 TTCATACAGGAGTGCTGGGAAGG + Intergenic
1033674283 7:143522435-143522457 CGCAAACAGCAGTGTAGTCATGG + Intergenic
1033687059 7:143650611-143650633 CGCAAACAGCAGTGTAGTCATGG + Intronic
1033697552 7:143807012-143807034 CGCAAACAGCAGTGTAGTCATGG - Intergenic
1034094327 7:148392640-148392662 CAGAAGCAGGAGTGGAGGGAAGG + Intronic
1034745667 7:153521733-153521755 TGCAAACTGGATTGTAGGGATGG + Intergenic
1035039149 7:155914750-155914772 TTCAAGCAGGAGTGCAAGGAGGG - Intergenic
1035160565 7:156947476-156947498 CTCAAACAGGGTTGTCAGGATGG + Intergenic
1035608488 8:945251-945273 CATAGACAGGAGTGCAGGGAAGG - Intergenic
1036615798 8:10386396-10386418 CTGAAGCAGGAGGGAAGGGAAGG + Intronic
1041038119 8:53816500-53816522 TTAAAACAGGAGTGTAGGCCGGG + Intronic
1041988530 8:63955908-63955930 CTCAAAAAGCAGTAGAGGGATGG - Intergenic
1042120376 8:65481007-65481029 GTCAAACAGGAGTGCAGGAAGGG - Intergenic
1048005831 8:130418830-130418852 TTCAACTAGGAGTTTAGGGAAGG - Intronic
1048476954 8:134752193-134752215 CTCAGACAGCAGTGTGGGGTGGG - Intergenic
1049540553 8:143206950-143206972 CTCACACAGCAGTGTGGGGTGGG - Intergenic
1049997775 9:1047793-1047815 CGCAGACGGGTGTGTAGGGAGGG + Intergenic
1050243982 9:3668642-3668664 CACTAACAGGAGTGAAGGGATGG + Intergenic
1050244441 9:3673199-3673221 CTCAAATAGGGGTGTAGTCAGGG + Intergenic
1052251213 9:26399419-26399441 CTAAAACTGGATTATAGGGATGG + Intergenic
1057423348 9:94929236-94929258 ATCAAACAGGTGGGGAGGGATGG + Intronic
1057997457 9:99831138-99831160 CTTAAACACAAATGTAGGGAAGG + Intronic
1061236952 9:129348898-129348920 CACAAACTGGAGTGTCTGGAAGG - Intergenic
1062132320 9:134905293-134905315 CTCAAGTAGGAGTGTAGGCGTGG - Intergenic
1062229647 9:135474575-135474597 CTCAAACAGGAGGGCCTGGAGGG - Intergenic
1062311248 9:135938651-135938673 CCCACCCAGGAGTGTTGGGAAGG + Intronic
1186845833 X:13530109-13530131 CTTAAACTGGATTGTGGGGATGG - Intergenic
1190808718 X:53863696-53863718 CTCAAAGATGAGTGGAGGGCCGG + Intergenic
1193791187 X:85816748-85816770 CCCAAACAGAAGTGCAGGTAAGG - Intergenic
1195282754 X:103352685-103352707 CTCAAACTTGATTGAAGGGAGGG + Intergenic
1195633495 X:107086489-107086511 CTCAATCAAAAGTGTTGGGAAGG - Intronic
1198720364 X:139611787-139611809 AGCAAACAGGGGTGCAGGGAAGG + Intronic