ID: 1091223270

View in Genome Browser
Species Human (GRCh38)
Location 11:133943437-133943459
Sequence CTCCCTCCAGGGAGACCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 247}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091223264_1091223270 6 Left 1091223264 11:133943408-133943430 CCTCCTTCCAGGGACACAAAGAG 0: 1
1: 0
2: 1
3: 31
4: 284
Right 1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG 0: 1
1: 0
2: 2
3: 30
4: 247
1091223266_1091223270 3 Left 1091223266 11:133943411-133943433 CCTTCCAGGGACACAAAGAGGAG 0: 1
1: 0
2: 1
3: 32
4: 310
Right 1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG 0: 1
1: 0
2: 2
3: 30
4: 247
1091223260_1091223270 17 Left 1091223260 11:133943397-133943419 CCTCCAGAGTACCTCCTTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG 0: 1
1: 0
2: 2
3: 30
4: 247
1091223259_1091223270 27 Left 1091223259 11:133943387-133943409 CCTTCTAGCTCCTCCAGAGTACC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG 0: 1
1: 0
2: 2
3: 30
4: 247
1091223267_1091223270 -1 Left 1091223267 11:133943415-133943437 CCAGGGACACAAAGAGGAGACTC 0: 1
1: 0
2: 0
3: 25
4: 422
Right 1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG 0: 1
1: 0
2: 2
3: 30
4: 247
1091223263_1091223270 14 Left 1091223263 11:133943400-133943422 CCAGAGTACCTCCTTCCAGGGAC 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG 0: 1
1: 0
2: 2
3: 30
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091223270 Original CRISPR CTCCCTCCAGGGAGACCCCG AGG Intronic
900420149 1:2552770-2552792 CTCCCCCCAGGGAGACCCCCTGG + Intergenic
900424282 1:2568888-2568910 CTCCCCCCAGGGAGACCCCCTGG - Intergenic
900430767 1:2602168-2602190 CTCCCTCCAGGGAGAAGTCAGGG + Intronic
900567228 1:3339470-3339492 CTTCCTCCAGGAAGCCCCTGTGG - Intronic
900606820 1:3527446-3527468 CCCACTCTGGGGAGACCCCGAGG + Intronic
900617210 1:3570868-3570890 CTCCCTCCAGCCATCCCCCGGGG + Intronic
900704138 1:4068293-4068315 CCCCTTCCAGAGAGACCCTGCGG - Intergenic
901005514 1:6169960-6169982 TTGCCTCCAGTGGGACCCCGCGG + Intronic
901215608 1:7553462-7553484 CTCCCTCCAGGGGAGCCCTGTGG - Intronic
901679731 1:10906129-10906151 CTCCCTCGAGGGACACACTGTGG + Intergenic
902756889 1:18554834-18554856 CTCCATCCAGGAAGCACCCGTGG - Intergenic
902796904 1:18806084-18806106 CTCACTCCTGGATGACCCCGGGG - Intergenic
902955781 1:19923374-19923396 CTGCCACCAGGGTGACCCTGAGG - Intronic
904524452 1:31122252-31122274 CTGCCTCCAGGCAGACCGGGAGG - Intergenic
905043010 1:34976118-34976140 CTGCCTGCAGGGAGACGCAGGGG + Intergenic
905731964 1:40303960-40303982 CTCTCTGCAGGGTGACCCAGGGG - Exonic
905945522 1:41898315-41898337 CCCCCTCCAGGGAGACTGCCAGG - Intronic
906209132 1:44002571-44002593 CTCCCTCCAGGGTCACTCCGCGG + Exonic
907707497 1:56845488-56845510 TTCCCTCCGGGGAGTCCCCAAGG + Intergenic
907963654 1:59307984-59308006 CTCCCTTCCTGGAGACCCCCTGG - Intronic
908554888 1:65248069-65248091 CTCGCTCCAGGCAGATCCAGTGG - Intergenic
909546519 1:76854344-76854366 GTCCCTCCAGGGAGACAGCAAGG - Intergenic
915326544 1:155083783-155083805 CTCCCCCCAGGGAGCTCCCAGGG + Intronic
916599221 1:166276087-166276109 CTCCCTCCAAGAGGACCCCAGGG - Intergenic
919924041 1:202183118-202183140 CTCCCACCAGGTAGACCCACCGG + Intergenic
920414807 1:205791755-205791777 CTCTCTCCAGGGGGAGCCAGAGG + Intronic
920646425 1:207807353-207807375 CTCCCTCCAGGGAGGAGCAGAGG - Intergenic
920839055 1:209538547-209538569 CTCCCTCCAGGGTGAAGCTGAGG + Intergenic
921355403 1:214280907-214280929 CTCGCTCCGTGGAGACGCCGCGG + Intergenic
922321861 1:224495646-224495668 CTTCCTCCAGGAGGACCCCTTGG - Intronic
924529531 1:244881679-244881701 CTCCCTCCAGGAGGGCCCAGGGG - Intergenic
1069922149 10:71822258-71822280 CTCCATCCAGGGCCACCACGAGG + Intronic
1070404105 10:76079392-76079414 CTCCCTCCAGGCTGACCACATGG + Intronic
1071545285 10:86524306-86524328 CTCCCTCCAGGAGGGGCCCGAGG - Intergenic
1073009111 10:100346612-100346634 CTCCCTCCCGGGCGAGCGCGGGG - Intergenic
1073042254 10:100615625-100615647 CTCCCCCCAGGGTGCCCCAGCGG - Intergenic
1074548955 10:114425655-114425677 CTCCCTCCAGCCAGGCCCTGAGG + Intergenic
1074563939 10:114559559-114559581 CTGCCCCGAGGGAGACCCCAGGG - Intronic
1074772003 10:116741111-116741133 CTCACTCCAGGGAGAGGCAGCGG - Intronic
1075168498 10:120091414-120091436 CTCCCTCCAGGGAGCTGCTGGGG + Intergenic
1075320145 10:121485002-121485024 CACCCTGCAGGGCGGCCCCGCGG + Intronic
1075707514 10:124510445-124510467 CTGCCTCCAGGCAGAGCCCCGGG - Intronic
1075826630 10:125362378-125362400 TTCCATCCAGGGAGACCCAGAGG - Intergenic
1075913811 10:126148919-126148941 CTCCCTCCATGGAGTCCTCTAGG - Intronic
1076374287 10:129973009-129973031 CGCCCTCCCGGGAGAGCCCACGG + Intergenic
1076386908 10:130063640-130063662 CTCCCTCCAGGGAGTGTCCTCGG - Intergenic
1076426834 10:130372992-130373014 CTACCTCCAGGGTCACCCCTTGG + Intergenic
1076743837 10:132502692-132502714 CTTCCTCCAAAGAAACCCCGGGG - Intergenic
1076889774 10:133277737-133277759 CTCTCCCCAGGGAGGCCCTGAGG - Intergenic
1076920104 10:133446663-133446685 CACCGCCCAGGGAGAACCCGCGG + Intergenic
1077066026 11:641237-641259 CTCCCTCCAGGGAAGCCACTTGG - Intergenic
1077149156 11:1061072-1061094 CTCACTGCAGGGTCACCCCGAGG + Intergenic
1077333223 11:1992528-1992550 CACCGTTCAGGGAGACCCTGAGG - Intergenic
1077384704 11:2263415-2263437 CCCCCTCCAGGCAGACCCAAGGG + Intergenic
1077470876 11:2759933-2759955 CTCCATCCAGGCAGATCCTGAGG - Intronic
1078082893 11:8217090-8217112 CTCCCTCCAGGAAGACATCCCGG - Intergenic
1079360156 11:19763917-19763939 CTCTATCCATGGAGACCCCTCGG + Intronic
1081661197 11:44889445-44889467 CTGCCTCCAGAGAGAGCCTGGGG - Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083318191 11:61828893-61828915 CTGCCTCCAGACAAACCCCGAGG - Intronic
1083692540 11:64419175-64419197 TTCTCTCCAGGGAGGCCCAGAGG - Intergenic
1083782340 11:64924976-64924998 CTCCCTACGGGCAGCCCCCGGGG + Exonic
1084488965 11:69467877-69467899 CGCCCTTCAGGGAGGCCCCGAGG + Intergenic
1087283977 11:96244188-96244210 TACCCTCCAGGGAGACACTGAGG - Intronic
1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG + Intronic
1202816203 11_KI270721v1_random:47709-47731 CACCGTTCAGGGAGACCCTGAGG - Intergenic
1094107845 12:26832836-26832858 CTCTCTCCAGGGAGCCGCCGCGG + Exonic
1094199439 12:27780924-27780946 GTCCCCCCAGGAAGTCCCCGAGG - Exonic
1094494374 12:30980210-30980232 ATCCCTCCAGGGACACCCACTGG + Intronic
1096404040 12:51329821-51329843 CTCCCTGCAGGGTGACTCTGGGG - Exonic
1098973587 12:76879317-76879339 TCCCCTCCAGGGAGGCCCGGCGG + Intergenic
1100309354 12:93379243-93379265 CGCTCTCCAGGGAAACCCCAAGG - Intronic
1100830972 12:98516222-98516244 CTCCCTCCCGGGCGCCCCCTCGG + Intronic
1101008330 12:100424596-100424618 CTTCCTCCAGGGAGGACCAGAGG + Intergenic
1101723902 12:107374035-107374057 CTCCCACCATGGAGACTCAGTGG - Intronic
1101824557 12:108210069-108210091 CTGCCACCATGGAGACCCCGAGG - Intronic
1102027938 12:109724036-109724058 CACCCTGCAGGAAGCCCCCGGGG - Intronic
1102255196 12:111410942-111410964 CTTCCTCCAGGGAGGCCTCCTGG - Intronic
1102399693 12:112617661-112617683 CTTCCTCCAGGAAGTCTCCGAGG - Intronic
1103503124 12:121420579-121420601 CTCTCTCCTTGGAGAGCCCGGGG - Exonic
1103649780 12:122423147-122423169 CTCCCTCCAGGGAAAGACCCTGG + Intergenic
1104961160 12:132489414-132489436 CTCCCGCCACCGAGACCCCCGGG - Intergenic
1107412704 13:40172486-40172508 CTCCATCCAGGCTGCCCCCGTGG - Intergenic
1107727955 13:43318953-43318975 CTCCCTCCAGGTTGACTCTGTGG - Intronic
1107804752 13:44143337-44143359 CTTCCTCCAGGGAGCCACTGAGG - Intergenic
1108510145 13:51148576-51148598 CCCCCTCCAGGGGGACCTCAGGG - Intergenic
1110247928 13:73348061-73348083 CTCCATCCAGGGAGTCCCCTGGG - Intergenic
1112030331 13:95450706-95450728 CTCCCTCCAGGGAGAATGGGAGG - Intronic
1112787281 13:102964979-102965001 CTCCCGACATGGAGACACCGAGG + Intergenic
1113542973 13:111123236-111123258 CTACCTCCGAGGAGACCCCAGGG + Intronic
1113800179 13:113082417-113082439 CTCCCTGCAGGGCTACGCCGCGG + Exonic
1113893371 13:113748254-113748276 CTCCCTCCCTGGGGACCTCGTGG + Intergenic
1114683327 14:24505647-24505669 CCCCCTACAGGGAGACTCTGGGG - Exonic
1115835400 14:37397158-37397180 CTACATCAAGGGACACCCCGTGG - Intronic
1118902994 14:70002178-70002200 CTCCCTCCAGGGGGTCCTCCCGG + Intronic
1119378243 14:74212177-74212199 CTCCCTCGAAGGAGAGCCCAAGG - Intergenic
1119891401 14:78185243-78185265 CTCCCTCCATCGAAACCCCTGGG - Intergenic
1122100633 14:99406878-99406900 CTGCCACCAGGGAGGCCCAGAGG - Intronic
1122643753 14:103177693-103177715 CTCCCTCCAGGGACCCCCCTGGG - Intergenic
1123799724 15:23807372-23807394 CTCTCTCAAGTGAGACCACGTGG - Intergenic
1125750017 15:42021618-42021640 CTCCCTCCTGGGAGGCCAGGTGG + Intronic
1129253153 15:74319620-74319642 CCTCCTCCAGGAAGACCCCCGGG - Intronic
1129679017 15:77647425-77647447 TCTCCTCCAGGGAGACCCCTGGG - Intronic
1129756303 15:78101221-78101243 CTGCCTCCAGGTAGCCCCCAGGG - Exonic
1129782211 15:78279964-78279986 CTCCCTCATGGGAGAGCCTGCGG - Intronic
1129867643 15:78921699-78921721 CTCCCTCCTGGGAGACTGAGTGG + Exonic
1131064153 15:89422626-89422648 CTCCCTCCAGGAACACCCCCTGG - Intergenic
1131401206 15:92126976-92126998 CTTCCTCCAAGCAGACCACGAGG + Intronic
1132164029 15:99566641-99566663 ATCCCTTCGGGGAGACCCCCGGG - Intronic
1132586313 16:707012-707034 CTCACCCCAGGTAGACCCAGTGG - Intronic
1132754416 16:1475543-1475565 CTTCCTCCAGGCAGCCCCAGAGG + Exonic
1133001394 16:2853317-2853339 CTCTCTGCAGGGCGACTCCGGGG - Exonic
1133009893 16:2905140-2905162 CTCCTCCCTGGGAGACCCCAGGG - Intergenic
1133090667 16:3401412-3401434 CGGCCTCCAGGGCGGCCCCGCGG - Exonic
1133304361 16:4800418-4800440 CCCTCTCCAGGGAGGCCCCGCGG + Intronic
1133409484 16:5556623-5556645 CTCCCTCTTGGGAGAACCAGCGG + Intergenic
1134148983 16:11790787-11790809 CTGCCTCCTGGGAGAGACCGAGG - Intronic
1135402958 16:22178722-22178744 CTTCCTCCAGGGAGCCCTCCTGG - Intronic
1136569065 16:31086171-31086193 CTGGCTCCAGGGAGATTCCGGGG - Exonic
1137402622 16:48165572-48165594 CTGCCTCCAGGAAGTCCCCGGGG + Intergenic
1138456084 16:57121543-57121565 CTTCCTCCAGGGAGCCTCCCAGG - Intronic
1138551064 16:57748779-57748801 CGCCCTCCTGTGAGATCCCGTGG - Intronic
1139489551 16:67279159-67279181 CTCCCGCCAGGAAGGCCGCGTGG - Exonic
1139751680 16:69112791-69112813 CTGCCTCCAGGCAGACCCCAGGG - Intronic
1140645283 16:77023192-77023214 CTCCCTCCAGAGAACCCCCGGGG + Intergenic
1141524024 16:84599811-84599833 CTCGCTCCAGGGAGCTCCCTCGG - Intronic
1141882355 16:86868331-86868353 CTCCTTCCAGGGAGGGGCCGCGG - Intergenic
1141906334 16:87029185-87029207 CTCCCTCCAGGGCCACACCTGGG + Intergenic
1142031116 16:87839055-87839077 CTTGCTCCAGGGAGTCCCAGAGG - Intronic
1142194473 16:88733124-88733146 CTGCCTCCAGGAAGCCCCCTTGG + Intronic
1142324482 16:89405745-89405767 CTCCTTCCAGCCAGACCCTGGGG + Intronic
1142600563 17:1051593-1051615 CCACCTCCAGGGAGATGCCGAGG + Intronic
1143188368 17:5023926-5023948 CTCCATCCAGGGAGTTCCTGCGG - Exonic
1143548514 17:7614603-7614625 CCTCCTCCGGGGAGACGCCGGGG - Exonic
1144075323 17:11714440-11714462 CTACCTTCAGGGAGGCCCCGAGG - Intronic
1147214176 17:38889916-38889938 CTTCCTCCAGGAAGTCCCCCTGG + Intronic
1151557184 17:74852467-74852489 CGCCCTCCAGGAAGAGCGCGTGG + Exonic
1151885595 17:76921585-76921607 CTCCCTCCATGCACACCCAGTGG + Intronic
1152567711 17:81107548-81107570 CTCCGTCCAGGGAGGCTCCTGGG + Intronic
1152612640 17:81323183-81323205 CTCCGTCCAGGGCTCCCCCGAGG - Intronic
1153801845 18:8678076-8678098 CTGCCTCCACAGAGCCCCCGTGG - Intergenic
1154171627 18:12056871-12056893 CTTCCTCCAGGGAGTTCCTGCGG + Intergenic
1158588184 18:58758737-58758759 CTCACTCCATGGAGACACAGAGG + Intergenic
1160163498 18:76492083-76492105 ACCCCTGCAGGGAGACCCCTGGG - Intronic
1160165097 18:76504190-76504212 AGCGCTACAGGGAGACCCCGGGG - Intergenic
1160349746 18:78166673-78166695 CACCATCCAGGGACCCCCCGGGG + Intergenic
1160403466 18:78628615-78628637 CTTCCTCCAGGAAGACCACCTGG + Intergenic
1160556864 18:79731103-79731125 CAGCCTCCAGGGAGCACCCGGGG - Intronic
1160606914 18:80058612-80058634 CTCCCTCCAGGCACAACCCCTGG + Intronic
1160833625 19:1114410-1114432 TTCCCTGCAGGGCGACCTCGGGG - Exonic
1160932735 19:1578301-1578323 CCGACTCCAGGGAGCCCCCGTGG + Intronic
1160944987 19:1637402-1637424 TGCCCTCCAGGGAAACCCCAGGG - Intronic
1161010433 19:1957184-1957206 CTCCCTCCAGGCAGCCCCACAGG + Intronic
1161038280 19:2097194-2097216 ACCCCGCCAGCGAGACCCCGGGG + Intronic
1161663244 19:5560049-5560071 CCCCCTCCAGGCACACCCAGGGG + Intergenic
1161937905 19:7383324-7383346 TTCTCTCCAGGGAGCCGCCGAGG - Exonic
1162196930 19:8992151-8992173 TTCCCTCCAAGGAGACACCTGGG + Intergenic
1162424147 19:10583882-10583904 CCACCTCCAGGGACACCACGTGG + Intronic
1163164107 19:15483569-15483591 CTTCCTCCAGGGAGCCTCTGTGG + Intronic
1163468204 19:17481912-17481934 GTCCCTGCAGGGAGACCTGGTGG + Intronic
1163714092 19:18864033-18864055 CTGTCTCCAGGGAGAGCCCCTGG + Intronic
1163753054 19:19089949-19089971 CTCCCTCCAGGGACCCCCAGTGG - Intronic
1164763535 19:30745740-30745762 CTCCCTGCAGGGACAGGCCGTGG - Intergenic
925144473 2:1571654-1571676 GTCTCTCCAGGGAGAGCCCATGG - Intergenic
925213959 2:2076280-2076302 CTCATTCCTGGGTGACCCCGAGG + Intronic
926097845 2:10094021-10094043 GTCCCTGGAGGGAGACCCCGAGG - Intergenic
934661142 2:96144361-96144383 TTCCCTCCAGGGTGGCCCTGTGG - Exonic
935287777 2:101580463-101580485 CTCCCACCATGGAGACACCTGGG - Intergenic
936012926 2:108936532-108936554 CTTCCTCCAGGAAGACCCAAGGG + Intronic
937017214 2:118617017-118617039 CTTCCTCCAGGGAGTCCTCAAGG + Intergenic
937924498 2:127157540-127157562 TGCCCTCCAGGGAGCACCCGTGG - Intergenic
938207718 2:129438334-129438356 ATCCCTCCTGGGACACCCCCAGG + Intergenic
938457066 2:131473487-131473509 CACCCTCCAGGGAGATGCCATGG + Intronic
943564608 2:189503078-189503100 CTTCCTTCAGGGAGACCTGGTGG + Intergenic
945032891 2:205682110-205682132 CCCACCCAAGGGAGACCCCGGGG - Intronic
947867968 2:233414497-233414519 CTCCCTCCAGGGGGAGACCACGG + Intronic
948266654 2:236640032-236640054 CTCCCTCCAGGGAGAAGCCAGGG + Intergenic
948535556 2:238643900-238643922 CTCCCTCCAGGGGCACTCAGAGG - Intergenic
1169073690 20:2749344-2749366 TCCCCTCCCGGGAGCCCCCGAGG + Intronic
1169327586 20:4687381-4687403 CTCCCTCCAGGGGGACTGGGAGG - Intronic
1169759858 20:9079446-9079468 ATCCCTCCAGGGAGACAGAGGGG + Intronic
1171386178 20:24770722-24770744 CTCCCTCAAGGGCTACCCCATGG + Intergenic
1172108002 20:32528051-32528073 CCCCCTCCAGGGAGCCCCCTCGG - Intronic
1172376652 20:34447595-34447617 ATCCGTCCAGGGAGAGCCAGTGG + Intronic
1174397441 20:50256688-50256710 CTCCCTCCAGCTAGCCCCCATGG + Intergenic
1174416756 20:50372680-50372702 CTCACTCCAGGGAGGCTCAGGGG + Intergenic
1175739848 20:61412902-61412924 GTTTCTCCAGGGAGACCCTGAGG + Intronic
1175881650 20:62262834-62262856 AGCCCTCCAGGGACACCCCAGGG - Intronic
1175903279 20:62368247-62368269 CTGCCTCCAGGGAAGCCCCGAGG + Intergenic
1176184255 20:63769501-63769523 CTGCCTCCAGCGAGACCCTTGGG - Intronic
1179954022 21:44727901-44727923 CTTGCTCCAGAGAGACCCCTGGG + Intergenic
1180046619 21:45309198-45309220 CTCCCTCCAGGGGGCGCCAGGGG - Intergenic
1180075576 21:45459807-45459829 CTGCCTCCAGGAAGCCCCCTGGG + Intronic
1180091349 21:45535168-45535190 CCTCCTCCAGGGAGACCCCCCGG - Intronic
1181631667 22:24154938-24154960 CTCCCTCCACAGACACCCAGGGG - Intronic
1181775810 22:25159378-25159400 CTCCCTCCAAGGGCACCCCGGGG - Intronic
1182293341 22:29298804-29298826 TTCCCTCCAAGAGGACCCCGGGG + Exonic
1183189421 22:36312210-36312232 CTTCCTCCAGGCAGGCCCCCCGG - Exonic
1183315517 22:37135017-37135039 AGCCCTCCAGGGAGAGCCCCGGG - Intronic
1183371317 22:37434041-37434063 CTCCCTCCAGGGAGATGCTGGGG + Intergenic
1184418279 22:44364494-44364516 CTTCCTCCAGGGTGACCTCCTGG - Intergenic
1184517508 22:44971704-44971726 CCACCTCCAGGGAGCCCTCGTGG + Intronic
1184663631 22:45976607-45976629 CTGCCTCCGGGGCGTCCCCGTGG - Intronic
1185109851 22:48894864-48894886 CTCCCTCCAAGAAGATCCCAGGG + Intergenic
1185148455 22:49151547-49151569 CTCCCTCGAGGCTGACCCCCGGG - Intergenic
951770981 3:26257595-26257617 CTACCTCCAGGAAGATCCAGAGG - Intergenic
953021059 3:39113528-39113550 CTCCCTCCAGGGATCACCCATGG - Intronic
953035448 3:39206752-39206774 GGCCCTCCAGGCAGCCCCCGTGG + Intergenic
954104910 3:48404735-48404757 CTCCCGCCAGCGAGGCCCTGAGG - Intronic
957939942 3:86991321-86991343 CACCCTGCAGGGGGACCCCGGGG + Intergenic
961206988 3:125092100-125092122 CCCCCAACAGGGAGACCCAGGGG + Exonic
961444747 3:126974141-126974163 CCCTCTCCATGGAGACCCCCTGG + Intergenic
961670230 3:128523514-128523536 CTCCCTCCAGTGGGACTTCGGGG + Intergenic
962277871 3:134029673-134029695 CTCCGGCCCGGAAGACCCCGCGG + Intronic
964893197 3:161561253-161561275 CTCCCTACAGGGAGAGACGGAGG + Intergenic
968472072 4:786856-786878 ATTCCTCCAGGGACCCCCCGGGG - Intronic
968883078 4:3311082-3311104 CGGCCTCCAGGGTGACCCCACGG - Intronic
981534968 4:145789866-145789888 CTCTCTCCAGGCAGGCCCTGGGG - Intronic
985493602 5:192895-192917 CTCCCTCGAGGGAGACTGGGAGG - Intronic
999705946 5:154272505-154272527 GTCCCTCCAGGAACACCACGTGG + Intronic
1000318916 5:160118752-160118774 CTCCCTCCCTGGGGACCCAGCGG + Intronic
1002279101 5:178120498-178120520 CCCGGTCCAGGGAGCCCCCGAGG - Exonic
1004512253 6:16292490-16292512 CTCCTTCCAGGTAGCCCCCGAGG + Intronic
1005451430 6:25976706-25976728 TTCCCTCCAGGGAGATACCTTGG + Intronic
1006386027 6:33731349-33731371 GTCCCTCCAGGGAGACCTCCTGG - Intronic
1006983421 6:38162987-38163009 CTCCCTCCAGGCAGGGCCCTGGG + Intergenic
1006983433 6:38163016-38163038 CTCCCTCCAGGCAGGGCCCTGGG + Intergenic
1007370691 6:41425195-41425217 CTTACTCCAGGGAGGCCCAGAGG - Intergenic
1007429398 6:41767947-41767969 CTTGCTCTAGGGAGACCCCAGGG + Intergenic
1013391497 6:109690505-109690527 CTGCCTCCAGGGACTCCGCGGGG + Intronic
1015692317 6:135938751-135938773 ATCCCTGCAGGGAGATCCTGAGG - Intronic
1017430180 6:154363207-154363229 CCCCCTCCCTGGAGACCCCCGGG + Intronic
1019147338 6:169983803-169983825 GTCACTCCAGGGAGACCGCGAGG + Intergenic
1019287830 7:232347-232369 CCCCGTCCAGGGACATCCCGTGG + Intronic
1019542477 7:1557840-1557862 GTCCCTCCAGGGAGGCTCCCAGG + Intronic
1019735887 7:2649561-2649583 CTCCCAGCAGGCAGACCCTGGGG - Exonic
1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG + Intronic
1022037579 7:26549084-26549106 CTACCTCCAGGGATACTCAGGGG + Intergenic
1022116283 7:27263847-27263869 CTTCCTCAAGGAAGACCCTGAGG - Intergenic
1023659085 7:42454868-42454890 CTCCTTCCACTGAGACCCCAAGG - Intergenic
1024620358 7:51151849-51151871 CGTCCTCCTGGGAGACCCCACGG + Intronic
1026915830 7:74119983-74120005 CTCCCTCCAGGGCGATCTAGGGG + Intronic
1029528372 7:101109174-101109196 CTCCCTCCAGGCACACTCCCTGG - Intergenic
1034455676 7:151168346-151168368 CCCCCTCCAGCGAGAGCGCGGGG + Intronic
1035021870 7:155805154-155805176 CCCCCGCTAGGGGGACCCCGCGG + Intronic
1035724849 8:1817965-1817987 GGCGCTCCAGGGAGACCCTGGGG - Intergenic
1036765967 8:11549479-11549501 CACCCTCCTGGGAGCCCCCGAGG - Intronic
1037751598 8:21685923-21685945 ATTCCTCCAGGGAGAGCCCCAGG - Intergenic
1037950171 8:23014516-23014538 CTGCCACCAGGGGGACCCCAGGG - Intronic
1042801567 8:72723572-72723594 CCCACTCCTGGGAGACCCAGTGG + Intronic
1042990335 8:74632277-74632299 CTCTCGCCAGGGAGATCCAGAGG + Intronic
1043631481 8:82340556-82340578 TTCCCTTCAGAGAAACCCCGAGG - Intergenic
1047206065 8:122803644-122803666 CTTCCCCCATGGAGAACCCGTGG + Intronic
1049246866 8:141567476-141567498 CCCTCTCCAAGGAGTCCCCGGGG - Intergenic
1049470615 8:142773640-142773662 CTCACTGCAAGGAGACCCCTGGG + Intronic
1049599311 8:143499726-143499748 CACCCTCCACGGAGGCCCTGGGG + Intronic
1049658475 8:143809260-143809282 CTCACACCAGGGAGCCCACGGGG + Intronic
1055467093 9:76576672-76576694 CTCCCTGAAGGGTGACCCAGAGG + Intergenic
1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG + Intergenic
1059584371 9:115590359-115590381 CTCCCTCCAGGCAGACCTACTGG - Intergenic
1059769000 9:117410279-117410301 TTACCTCCAGGCAGCCCCCGGGG - Intronic
1060266859 9:122116670-122116692 CTCCCTCCAGGGTGAGTCCTGGG - Intergenic
1060423827 9:123488271-123488293 CTCCCTCCAGGGAGAACAAGAGG - Intronic
1060730424 9:126033600-126033622 CACCCTCCAGGCAGATCCCGAGG + Intergenic
1060794974 9:126507265-126507287 CTCCTTCCAGGAGCACCCCGAGG - Intergenic
1060966784 9:127716119-127716141 CCCCTTCCAGGAGGACCCCGAGG - Exonic
1061395643 9:130342165-130342187 CACCCTGCAGGGAGGCCCCATGG - Intronic
1061927072 9:133811129-133811151 ATCCCTCGGGGGAGACCCCCCGG + Intronic
1062031378 9:134363566-134363588 TGCCCTCCAGGGAGGCCCCAAGG + Intronic
1062047502 9:134431302-134431324 CTCCCTCCATGGAGACGCTGGGG - Intronic
1062253667 9:135610905-135610927 CTCCCTCCATGGAGATGCCAGGG + Intergenic
1062272080 9:135714321-135714343 CTCCCTCCAAAGCGGCCCCGGGG - Intronic
1062274309 9:135723602-135723624 CTGCCTCCAGAGGGACCCTGGGG + Intronic
1062581088 9:137229539-137229561 CACCCTCCCGGTACACCCCGGGG - Exonic
1062638789 9:137506182-137506204 CTCCCTCGAGGGAGCTGCCGGGG - Intronic
1185736620 X:2500817-2500839 CTGGCTCCAGGAAGCCCCCGCGG + Exonic
1197749496 X:129954862-129954884 CTCCCTCCAGGGAGGACTGGGGG - Intergenic
1200127565 X:153823704-153823726 CTCCACCCAGTGAGATCCCGGGG + Intronic
1201774499 Y:17648513-17648535 CCCACTCCAGGGAAACCCCTGGG + Intergenic
1201827057 Y:18257476-18257498 CCCACTCCAGGGAAACCCCTGGG - Intergenic