ID: 1091225336

View in Genome Browser
Species Human (GRCh38)
Location 11:133953736-133953758
Sequence GGGCCGTGCTTAGCTGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091225336_1091225346 10 Left 1091225336 11:133953736-133953758 CCACAATCAGCTAAGCACGGCCC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1091225346 11:133953769-133953791 CACAGAGTAGGAACTCCCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 154
1091225336_1091225345 9 Left 1091225336 11:133953736-133953758 CCACAATCAGCTAAGCACGGCCC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1091225345 11:133953768-133953790 CCACAGAGTAGGAACTCCCCCGG 0: 1
1: 0
2: 0
3: 20
4: 145
1091225336_1091225347 14 Left 1091225336 11:133953736-133953758 CCACAATCAGCTAAGCACGGCCC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1091225347 11:133953773-133953795 GAGTAGGAACTCCCCCGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 69
1091225336_1091225341 -2 Left 1091225336 11:133953736-133953758 CCACAATCAGCTAAGCACGGCCC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1091225341 11:133953757-133953779 CCAGGGTCCTCCCACAGAGTAGG 0: 1
1: 0
2: 1
3: 21
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091225336 Original CRISPR GGGCCGTGCTTAGCTGATTG TGG (reversed) Intronic
907404328 1:54244594-54244616 GGGCCGTCCTGAGCTGAATCTGG - Intronic
907525611 1:55052402-55052424 CGGCCGTGCTTACCTGTCTGTGG - Exonic
915111026 1:153564762-153564784 GGGCAGAGCTTTGCTGCTTGGGG + Intronic
917505243 1:175621413-175621435 GGGCAGTGAGTAGCTGAGTGTGG - Intronic
920596048 1:207271155-207271177 GGGCCCTGGGTAGCTGATAGTGG - Intergenic
922186240 1:223277424-223277446 GGTCCCTGGTTACCTGATTGTGG - Intronic
922865673 1:228859607-228859629 GGGGCCTCCTTAGCTGATTTCGG - Intergenic
1066216262 10:33290991-33291013 GGGCAGTGCATAGCGGGTTGTGG + Intronic
1067288880 10:44927211-44927233 GGTCCGTGCTGTGCTGGTTGTGG + Intronic
1086267298 11:85016654-85016676 GGACAGTGCGTAGCTGAGTGTGG - Intronic
1091225336 11:133953736-133953758 GGGCCGTGCTTAGCTGATTGTGG - Intronic
1100893622 12:99154751-99154773 CGGCCGTGCATTGCTCATTGTGG - Intronic
1106815007 13:33397921-33397943 GGGTCGTGTTTAGCTCATGGGGG - Intergenic
1106921911 13:34573219-34573241 GGGCCAAGCTTATGTGATTGGGG - Intergenic
1114276974 14:21155434-21155456 GGTCTGTGCCTCGCTGATTGTGG - Exonic
1122971677 14:105154784-105154806 GGGCCGGGGTTAGCTGGATGTGG - Intronic
1123109423 14:105858754-105858776 GGGCTGGGCTGAGCTGATTTGGG - Intergenic
1133155492 16:3872408-3872430 GGGCCGTGCTCTGCTGACAGGGG - Intronic
1138614891 16:58157464-58157486 GGGCCCTCCTTGGCTGAGTGTGG + Intergenic
1147357172 17:39907194-39907216 GGACTGTGCCTAGATGATTGAGG + Intronic
1148386526 17:47238432-47238454 GGGCCGTGCTTAGGGGACCGGGG - Intergenic
1148581415 17:48746740-48746762 GGGCCGTGCTTGGCTGACAGTGG + Intergenic
1152931419 17:83112040-83112062 GGGCCGTGCTCAGCGGTGTGTGG + Intergenic
1153755784 18:8281415-8281437 GGGCCATGCTTAAGTGATTTTGG - Intronic
1156278000 18:35603282-35603304 GTGCAGTGCCTAGCAGATTGTGG + Intronic
1156751950 18:40469999-40470021 GGGCCTTGCTTTGCCAATTGAGG - Intergenic
1159405533 18:67997794-67997816 GGCCCAGGCTTAGCTGATTTTGG + Intergenic
1160658873 19:289102-289124 GGGCCCTGCTGAGCTGAGGGTGG + Intronic
925351496 2:3204029-3204051 GGGCCGTGCTGAGCACTTTGAGG + Intronic
940160017 2:150701767-150701789 GGGGCCTGATTAGCTGATGGGGG - Intergenic
942524452 2:176838603-176838625 GGGCCCTGGTGAGCTGACTGGGG + Intergenic
947130294 2:226915907-226915929 GGGCTGGGCTTAGCTGATTTTGG + Intronic
947363808 2:229373384-229373406 GGGACGTGATTATCTTATTGTGG - Intronic
947801093 2:232928728-232928750 GGGTCGTGCGTAGCTGAGCGTGG - Intronic
1185068123 22:48642106-48642128 GGCCTGTGCTTTGCTGAGTGGGG + Intronic
954294041 3:49664382-49664404 AGGCCGTGCATAGCTCATTATGG + Intronic
968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG + Intronic
974646659 4:64703436-64703458 TCGAAGTGCTTAGCTGATTGAGG - Intergenic
980390631 4:132141337-132141359 GGGTCTTGCTTAGCTCATTCTGG - Intergenic
991109203 5:62879567-62879589 GGGGGGTGCTATGCTGATTGGGG + Intergenic
995725983 5:115180437-115180459 GGGCCGCGCTGAGCCGAGTGCGG - Intronic
998174697 5:139894632-139894654 GGGCTGGGCTTAGGTGACTGAGG - Intronic
998529250 5:142869947-142869969 GGGCTGTGCTTCTCTGAGTGAGG - Intronic
1020213771 7:6173427-6173449 GGGCCGTGCTTTCCTCACTGTGG - Intronic
1024678274 7:51657560-51657582 GGACCTGGCTTTGCTGATTGCGG + Intergenic
1027425768 7:78060442-78060464 GTACAGTGCTTAGCAGATTGAGG - Intronic
1029646145 7:101857190-101857212 GGCCTCTGCTTATCTGATTGGGG + Intronic
1049427045 8:142542362-142542384 GGGCCGTGCTGAGGTGGATGAGG - Exonic
1056259402 9:84832972-84832994 AGGCCGTGCTGGGCTGAGTGGGG + Intronic
1191845699 X:65546117-65546139 GGGAGGTGCTTATCTCATTGAGG - Intergenic
1197712752 X:129683722-129683744 GGAATGTGCTTAGCTGTTTGAGG + Intergenic
1197723061 X:129758101-129758123 GGGCCGTACTGAACTGATGGAGG + Intronic