ID: 1091226051

View in Genome Browser
Species Human (GRCh38)
Location 11:133956941-133956963
Sequence AGGTGCCGCTGCGCCGGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 256}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091226051_1091226064 29 Left 1091226051 11:133956941-133956963 CCGGCCCCGGCGCAGCGGCACCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1091226064 11:133956993-133957015 GGTCCACGGTGAAGCCTAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 54
1091226051_1091226065 30 Left 1091226051 11:133956941-133956963 CCGGCCCCGGCGCAGCGGCACCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1091226065 11:133956994-133957016 GTCCACGGTGAAGCCTAGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 65
1091226051_1091226059 8 Left 1091226051 11:133956941-133956963 CCGGCCCCGGCGCAGCGGCACCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1091226059 11:133956972-133956994 CGCCCGGGCGGAGCGCAGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 244
1091226051_1091226057 -4 Left 1091226051 11:133956941-133956963 CCGGCCCCGGCGCAGCGGCACCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1091226057 11:133956960-133956982 ACCTGCACTACTCGCCCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 32
1091226051_1091226055 -8 Left 1091226051 11:133956941-133956963 CCGGCCCCGGCGCAGCGGCACCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1091226055 11:133956956-133956978 CGGCACCTGCACTACTCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 47
1091226051_1091226062 15 Left 1091226051 11:133956941-133956963 CCGGCCCCGGCGCAGCGGCACCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1091226062 11:133956979-133957001 GCGGAGCGCAGCCAGGTCCACGG 0: 1
1: 0
2: 2
3: 15
4: 120
1091226051_1091226056 -7 Left 1091226051 11:133956941-133956963 CCGGCCCCGGCGCAGCGGCACCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1091226056 11:133956957-133956979 GGCACCTGCACTACTCGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091226051 Original CRISPR AGGTGCCGCTGCGCCGGGGC CGG (reversed) Exonic
900125476 1:1067277-1067299 AGGTGCAGGTGCGGCGGGGCAGG - Intergenic
900125868 1:1068763-1068785 AGATGCAGGTGCGGCGGGGCGGG + Intergenic
900125880 1:1068802-1068824 AGGTGCAGGTGCGGCGGGGCGGG + Intergenic
900132080 1:1091527-1091549 AGGTGCCGCAGCGCCATGCCAGG + Exonic
900389363 1:2427364-2427386 AGGGGCGGCTGAGCTGGGGCGGG - Intronic
900429878 1:2596459-2596481 AGGTGCCCCTGAGCCTGGGCGGG + Intronic
900627946 1:3618026-3618048 GGGTGTCGCTGCCCCAGGGCAGG - Intergenic
901660136 1:10794078-10794100 AGGAGCAGCTGCGCCGGGCATGG - Intronic
901691093 1:10973871-10973893 AGCTGCCGCTGCACCCGGGAAGG - Intronic
902336749 1:15758647-15758669 AGGGGCCGCTTCCGCGGGGCGGG + Intronic
902437236 1:16406265-16406287 ATGAGCCGCTGCGCCCGGCCTGG + Intronic
902478759 1:16701043-16701065 GGGGGCAGCTGCGACGGGGCGGG - Intergenic
902505604 1:16937747-16937769 AGGTGCCCCTGAGATGGGGCAGG + Intronic
902520252 1:17011760-17011782 GAGGGCCGCAGCGCCGGGGCCGG - Exonic
902870836 1:19312610-19312632 AGGGGCCGGTCGGCCGGGGCAGG - Exonic
903055474 1:20633445-20633467 CGGTGCCTCTGCGCAGGCGCAGG - Exonic
904006642 1:27366511-27366533 CCGTGGCGCTGAGCCGGGGCCGG - Exonic
904563332 1:31413150-31413172 AGGTGGGGCGGGGCCGGGGCGGG + Intronic
904603094 1:31684254-31684276 AGGAGCCCATGAGCCGGGGCTGG + Intronic
905120981 1:35681681-35681703 ATGAGCCACTGCGCCGGGCCTGG - Intergenic
905584350 1:39105340-39105362 CGCTGCAGCCGCGCCGGGGCGGG + Intronic
906242367 1:44249767-44249789 AGGAGCCGCTGAGCCTGGTCAGG + Intronic
907300535 1:53483939-53483961 AGGTGCAGCAGAGCAGGGGCAGG + Intergenic
913449455 1:118983359-118983381 TTGTGCCACCGCGCCGGGGCCGG + Intronic
915328069 1:155091619-155091641 AGGTGGCGCAGCACCTGGGCTGG + Intergenic
916048931 1:161021301-161021323 AGGCGCCAGTGCGCCGAGGCGGG - Exonic
916233346 1:162561658-162561680 GGGGGCCGCGGCGGCGGGGCGGG - Exonic
920365902 1:205448281-205448303 AGGTGCAGCTGCGCAGGAGAAGG + Intronic
922766397 1:228158683-228158705 GGGGGCCGCGGCGCGGGGGCGGG - Exonic
924637698 1:245804317-245804339 AAGTGCCACTGCGCCCGGCCGGG - Intronic
924732570 1:246724946-246724968 AGGTGCCCCCGCTGCGGGGCAGG - Intronic
1062831062 10:606198-606220 AGGTGCTGCTGGGCCGTGGCTGG - Intronic
1063474923 10:6319914-6319936 ATGTGCCACTGCGCCTGGCCAGG - Intergenic
1065983799 10:30930088-30930110 AGGTGCCGCAGAGCAGGGGGCGG + Intronic
1072241172 10:93496732-93496754 AGGACCCGCAGCCCCGGGGCCGG + Exonic
1076710622 10:132331940-132331962 TGGTGCGCCTGCGCTGGGGCGGG - Intergenic
1077365578 11:2160214-2160236 CTGTGACGCTGCCCCGGGGCGGG - Intronic
1082025055 11:47565600-47565622 GGTCGCCGCTGCGCCGGGCCGGG + Exonic
1083265763 11:61546209-61546231 AGTGGCCGCCGCGGCGGGGCTGG - Exonic
1083970422 11:66070772-66070794 AGGTTCATCTGCACCGGGGCGGG - Exonic
1084065775 11:66703448-66703470 ATGAGCCACTGCGCCGGGTCAGG - Intronic
1084149371 11:67281027-67281049 AGGTGCCTCTGCCCCAGGGCTGG + Intronic
1084526808 11:69703225-69703247 CGGGGCGGATGCGCCGGGGCGGG - Intronic
1089700302 11:120240400-120240422 AGGTGTCACTGCGCGTGGGCAGG + Intronic
1089800611 11:121024153-121024175 AGGTGAAGCGGCGCCGGGCCGGG + Exonic
1089943264 11:122441229-122441251 AGGTGGGGCAGCGCGGGGGCGGG + Intergenic
1091226051 11:133956941-133956963 AGGTGCCGCTGCGCCGGGGCCGG - Exonic
1091740771 12:2959266-2959288 AGGGGCCGGGCCGCCGGGGCGGG - Intergenic
1092767840 12:11869540-11869562 AGGGGCCGCTGCTCGGGGTCAGG - Exonic
1096124681 12:49110581-49110603 AGGTGCCTCTGGGCCCGGGGAGG + Exonic
1096784628 12:54009880-54009902 AGGCTCCGCTGGGGCGGGGCAGG + Intronic
1098677682 12:73311230-73311252 ATGAGCCACTGCGCCGGGCCTGG + Intergenic
1102210791 12:111125459-111125481 ATGTGCCACTGCGCCCGGCCTGG + Intronic
1104866863 12:131961075-131961097 AGGTGCCCCTGGCCCTGGGCTGG + Exonic
1104885413 12:132104443-132104465 AGGTGCCCCTGGCCCTGGGCTGG + Exonic
1104892881 12:132148769-132148791 AGGGGCAGCTGGGCGGGGGCCGG - Exonic
1105277481 13:18944283-18944305 GGCTGCCCCTGCGCCGGGCCCGG - Intergenic
1106208768 13:27621830-27621852 AGGAGCCGCAGCGGCGCGGCAGG - Exonic
1107468175 13:40667268-40667290 AGGAGCCGCGGCGCCGGGGGTGG - Intergenic
1108430122 13:50344945-50344967 AGGTGCTGCTGAGGCAGGGCTGG - Intronic
1113634975 13:111913228-111913250 CGGTGCCACTGCGGCAGGGCTGG - Intergenic
1113810744 13:113141079-113141101 CGCTGCCGCTGGGCCGGGCCAGG + Intronic
1115547832 14:34479039-34479061 AGGAGCCACTGCGCCCGGCCAGG - Intergenic
1116945449 14:50831196-50831218 AGGAGGAGCCGCGCCGGGGCCGG - Intergenic
1117131951 14:52695668-52695690 ACGTGCCGCGGCGCCCGCGCCGG + Exonic
1122736649 14:103847424-103847446 AGCTGCCGCCTCGCCGCGGCCGG - Exonic
1122938805 14:104972100-104972122 AAGTGCCCCTGCCCTGGGGCTGG - Intronic
1123108563 14:105854677-105854699 AGGTTCAGCTGCTCCCGGGCTGG + Intergenic
1123833971 15:24169320-24169342 ATGTGCTGGTGGGCCGGGGCAGG - Intergenic
1124190710 15:27574257-27574279 AGGTGGCGCTGCGGCGGGTCGGG + Intergenic
1128323380 15:66707517-66707539 AGGGGCCGCTGAGCCGGGCAGGG - Intronic
1128374589 15:67066001-67066023 AGTTGCCGGGGCGCCGGGCCGGG - Exonic
1128514255 15:68332317-68332339 AGGTACAGCTGGGCAGGGGCTGG - Exonic
1131231716 15:90665008-90665030 AGGGTCCGCTGCACCGGGCCAGG - Intergenic
1131830898 15:96354056-96354078 AGGAGGCGCTGTGCCCGGGCTGG + Intergenic
1132316697 15:100895504-100895526 AGGTGCCTCTGATCCTGGGCAGG + Intronic
1132856562 16:2047688-2047710 AGGTAGCGCCGCGCCGTGGCTGG - Exonic
1133097471 16:3457655-3457677 AGGGCCTGCAGCGCCGGGGCTGG - Intronic
1134402189 16:13920371-13920393 AGGTGCGGCCGCGCTGGCGCGGG + Exonic
1135607367 16:23836121-23836143 CGGTCCCGCGGCCCCGGGGCCGG + Exonic
1136365196 16:29806441-29806463 AGGCCCCGCGGGGCCGGGGCCGG - Intronic
1136909188 16:34132840-34132862 ACGTGCCGCAGCGCCCCGGCTGG - Intergenic
1138566293 16:57835665-57835687 ATGAGCCACTGCGCCTGGGCTGG - Intronic
1139509082 16:67416248-67416270 AGGCGCGGCTGCCCCGGGGAGGG - Exonic
1141165948 16:81661260-81661282 AGGTTCCTCTGCGCAGTGGCTGG + Intronic
1141694746 16:85614057-85614079 GGGAGCCGCTCCGCCGGGGGTGG - Intronic
1142395348 16:89828566-89828588 AGCTGCGGCGGCGCCGCGGCGGG + Exonic
1143114649 17:4575771-4575793 AGGTGGGGCTGGGCTGGGGCTGG + Intergenic
1143574569 17:7783357-7783379 ATGAGCCACTGCGCCGGGCCAGG + Intronic
1144021275 17:11241417-11241439 AGGCGCCGCAGCGCCATGGCGGG - Exonic
1144930920 17:18858221-18858243 AGCTGAGGCTGCGGCGGGGCCGG + Exonic
1145314845 17:21723459-21723481 AGGTGCTGCTGCCCCGGAGAGGG + Intergenic
1145713286 17:26995396-26995418 AGGTGCTGCTGCCCCGGAGAGGG + Intergenic
1147030559 17:37631449-37631471 AGTTGCCTCTGAGCAGGGGCAGG + Intronic
1147133476 17:38421994-38422016 AGGTGGGGCTGGGCAGGGGCTGG + Intergenic
1147210420 17:38869918-38869940 ACGTGGGGCTGCGCGGGGGCGGG - Exonic
1147989591 17:44324686-44324708 AGGCGGCACTGGGCCGGGGCTGG - Intronic
1148063701 17:44853568-44853590 AGGAGCCCCTGCACCGGGGCGGG - Exonic
1149654762 17:58304467-58304489 AGGTGGCCCTGCGCAGGGGTGGG + Intronic
1149806230 17:59620172-59620194 AGGTGCGGCCGGGCCCGGGCTGG + Exonic
1150475349 17:65470782-65470804 AGGTGGGGCTGCCCAGGGGCTGG + Intergenic
1151278942 17:73057245-73057267 AGGGGCCGCTGCACCTGGCCAGG + Intronic
1152531281 17:80920676-80920698 AGGCGCTGCTGGGCTGGGGCCGG - Intronic
1152755642 17:82085911-82085933 AGGTGCCCCTGACCTGGGGCTGG + Intronic
1152772530 17:82179111-82179133 AGGTGCAGCTGGGCCTGGACTGG - Exonic
1152980027 18:268037-268059 AGGCGCCGCAGCGCAGTGGCGGG - Intronic
1153822934 18:8847794-8847816 AGGGGCCACTGTGCAGGGGCTGG - Intergenic
1156489992 18:37490570-37490592 AGCTTCCTCTGAGCCGGGGCTGG + Intronic
1157749178 18:50162877-50162899 AGATGCCGCTGTGACAGGGCTGG - Intronic
1158393583 18:57062887-57062909 ATGTGCCGCTGCCCAGGAGCCGG + Intergenic
1158633830 18:59139453-59139475 TGGTGCCTCTACGCTGGGGCGGG - Intergenic
1160786457 19:902125-902147 AGGGGCCTGTGGGCCGGGGCAGG + Exonic
1160931835 19:1574497-1574519 AGGGGCATCTGCGCCGTGGCCGG + Intronic
1160989707 19:1855490-1855512 AGATGGCGCTGGGCAGGGGCGGG + Intronic
1161077068 19:2290971-2290993 TGGTGCCGCAGCGCGGCGGCCGG + Exonic
1161115578 19:2494914-2494936 TGGGGCCCCGGCGCCGGGGCCGG + Intergenic
1162034819 19:7933115-7933137 AGGGGCCTCTGCGCCTGGCCAGG - Intronic
1162985189 19:14265333-14265355 GGGTGGGGCTGCCCCGGGGCTGG + Intergenic
1164835112 19:31350877-31350899 TGGGGCGGCCGCGCCGGGGCCGG + Intergenic
1165096150 19:33410975-33410997 CTGGGCCGCTGCCCCGGGGCAGG - Intronic
1166669904 19:44703605-44703627 AGGTGCCTGAGTGCCGGGGCAGG - Exonic
1167203497 19:48084340-48084362 ATGAGCCACTGCGCCGGGCCAGG + Intronic
1167738780 19:51311925-51311947 AGGTACCGCAGCGCCGGGGGCGG + Exonic
1168339800 19:55616405-55616427 AGGCGCTGCAGCGCTGGGGCCGG - Exonic
1202647042 1_KI270706v1_random:152578-152600 AGGGGCGGCTGCACCAGGGCAGG - Intergenic
1202712778 1_KI270714v1_random:26874-26896 GGGGGCAGCTGCGACGGGGCGGG - Intergenic
925141057 2:1550165-1550187 AGGTGTCCCTGCTCCAGGGCTGG + Intergenic
926092704 2:10060945-10060967 ATGAGCCACTGCGCCGGGCCAGG - Intronic
926202672 2:10812810-10812832 AGGGGCGGCCGCGCGGGGGCGGG + Intronic
926295426 2:11565343-11565365 ATGTGCCCCTGGGCGGGGGCAGG - Intronic
926784738 2:16508333-16508355 AGACGCCGCAGCGGCGGGGCAGG - Intergenic
927714291 2:25342125-25342147 CGGCTCCGCAGCGCCGGGGCCGG - Intronic
927751328 2:25673284-25673306 AGCTCGCGCTGCGCCGGGACTGG - Intronic
929604696 2:43226643-43226665 GAGTGCGGCTGCGGCGGGGCGGG + Intergenic
931372071 2:61672929-61672951 ATGAGCCACTGCGCCGGGCCTGG - Intergenic
931487131 2:62705340-62705362 AGGCGCCGCTGGTGCGGGGCTGG - Intronic
931719440 2:65056564-65056586 GGGTGCCGCGGCGCTGGGGGCGG + Intronic
931881603 2:66575953-66575975 AGGCGCCTCTGCTCCGGGGTCGG - Intergenic
932054850 2:68433338-68433360 AGCTGCCGCTGTGCCTGGGATGG + Intergenic
933710953 2:85325758-85325780 AGGAGCCACTGCACCGGGCCAGG + Intronic
934049797 2:88200462-88200484 CTGAGCCGCTGCGCGGGGGCGGG + Intergenic
935137794 2:100322368-100322390 AGAGGCCGCTGCGCGTGGGCAGG - Exonic
935172556 2:100621736-100621758 ATGTGCTGTTGCTCCGGGGCAGG + Intergenic
936097377 2:109541445-109541467 AGGGGGAGCTGGGCCGGGGCAGG - Intergenic
936146951 2:109986656-109986678 AGGTGGTGCTGGGCTGGGGCTGG - Intergenic
936197741 2:110384827-110384849 AGGTGGTGCTGGGCTGGGGCTGG + Intergenic
937205791 2:120236437-120236459 AGGGGCAGCTGCACCTGGGCTGG - Intergenic
941020955 2:160407620-160407642 AGCTGCCGCGGCCCCGGGCCCGG - Intronic
946647125 2:221849583-221849605 AGGTGCTGCTGAGGCGGGCCAGG - Intergenic
946865742 2:224039551-224039573 ACGTGCAGCTGGGCCCGGGCTGG - Intergenic
947119456 2:226799959-226799981 GGGAGGCGCTGCGCCGGAGCTGG - Intergenic
948192490 2:236070754-236070776 GGGTGGCCCTGGGCCGGGGCAGG + Intronic
1169137236 20:3204509-3204531 AGATGCCGCTGCACCAGGGTTGG - Intronic
1169382389 20:5119532-5119554 AGGTGCAGGCGGGCCGGGGCCGG + Intronic
1172118509 20:32584855-32584877 CGCTGCTGCTGCGCGGGGGCTGG - Intronic
1172640209 20:36436192-36436214 AGCTGCCGCTGCGCATGCGCCGG - Exonic
1173594151 20:44247870-44247892 AGGTGCTGCTGCTGCGGGGAGGG + Intronic
1173819716 20:46012321-46012343 TGGTCCCGCGGCTCCGGGGCTGG + Intronic
1174421148 20:50399915-50399937 AGGTGGGGCTGGGCCAGGGCAGG - Intergenic
1175257892 20:57657899-57657921 ACGTGCCGCAGCCCCAGGGCTGG + Intronic
1175264689 20:57695515-57695537 GTGAGCCGCTGCGCCGGGCCAGG - Intronic
1175847166 20:62065220-62065242 AGTTTGCGCGGCGCCGGGGCCGG + Exonic
1175856193 20:62122266-62122288 AGGCGCCGCTGGCCGGGGGCGGG - Intergenic
1175913529 20:62415529-62415551 ATGTGCAGCTGGGCCGGCGCAGG - Intronic
1176414800 21:6468056-6468078 AGGGGGCGCCGCGCCGGGGCGGG + Intergenic
1176604826 21:8820196-8820218 AGGGGCGGCTGCACCGGGGCAGG + Intergenic
1176869193 21:14072860-14072882 AGCAGCCCCTGCGCCGGGCCCGG - Intergenic
1177010927 21:15729903-15729925 AGGAGCCGCCGGGCGGGGGCGGG + Intergenic
1178992567 21:37367493-37367515 AGGAGCCGGAGCGCCGGGGGCGG + Intronic
1179491853 21:41746087-41746109 AGGTGGCGCTCCCCCGGGGAAGG - Intronic
1179690300 21:43076378-43076400 AGGGGGCGCCGCGCCGGGGCGGG + Intronic
1180347116 22:11711801-11711823 AGGGGCGGCTGCACCGGGGCAGG + Intergenic
1180354866 22:11829891-11829913 AGGGGCGGCTGCACCGGGGCAGG + Intergenic
1180383385 22:12162440-12162462 AGGGGCGGCTGCACCGGGGCAGG - Intergenic
1181308504 22:21930785-21930807 AGGTGATGCTGCCCCGAGGCTGG - Intronic
1181592502 22:23894090-23894112 AGGAGGCGCTGTGCCGGGGGTGG - Exonic
1181831748 22:25565242-25565264 AGCCTCCGCTGCCCCGGGGCGGG + Intronic
1182320111 22:29473274-29473296 GGGTGCAGCTGCCCCTGGGCAGG + Intergenic
1183071692 22:35400604-35400626 AGGTGCGGCTCCTGCGGGGCCGG + Exonic
1184358021 22:43995646-43995668 GGGTGCCCCTGAGCCGGGTCTGG + Intronic
1184645816 22:45894742-45894764 ATGAGCCACTGCGCCGGGCCTGG - Intergenic
950362397 3:12458959-12458981 AGGCGCCTCTGGGCCGGGGCGGG + Intergenic
951729199 3:25791854-25791876 AGGTGCAGCTGTGCTGGTGCTGG + Exonic
951858238 3:27222088-27222110 ATTTGCCGCTGCGCCTGGCCAGG - Intronic
952885851 3:38010544-38010566 ATCTGCCGCTGCGCCTTGGCTGG + Exonic
954277918 3:49554554-49554576 GGGTCGCGCTGCGCCCGGGCCGG - Exonic
954882628 3:53846147-53846169 AAGTGCCGCGGGGCAGGGGCCGG - Exonic
954912500 3:54121753-54121775 GGGGGCCGCTGCGCTGCGGCCGG + Intergenic
961743378 3:129047318-129047340 TGCTGCCGCTGAGCAGGGGCTGG + Intergenic
963798686 3:149656917-149656939 AGCTGCCACTGCCCCCGGGCTGG - Exonic
966860601 3:184229476-184229498 TGCTGCTGCTGCGGCGGGGCTGG - Intronic
967883159 3:194315687-194315709 AGGTGCCGATGCACGGGGGCGGG + Intergenic
967904085 3:194486738-194486760 AGGAGGCGCCGCGGCGGGGCCGG + Intronic
968229591 3:196997506-196997528 AGGTGCCTCAGCGCCTGGCCCGG - Intronic
968478917 4:825528-825550 GGGTGCGGGTGCGGCGGGGCCGG - Intronic
968493495 4:903121-903143 AGGTGGTTCTGGGCCGGGGCTGG - Intronic
968571877 4:1346527-1346549 AGGTACCCCTGGGCCCGGGCTGG - Intergenic
968918062 4:3505962-3505984 AGGTTCAGCTCCTCCGGGGCTGG - Intergenic
969650101 4:8461128-8461150 ATGAGCCGCTGCGCCGGGCCAGG + Intronic
969791875 4:9498327-9498349 AGGCGCCCCAGCGCCGGAGCAGG + Intergenic
971876945 4:32319346-32319368 AGGTGCTGCTGCGCCAGGGTGGG + Intergenic
973373294 4:49270741-49270763 AGGGGCGGCTGCACCGGGGCAGG - Intergenic
973387710 4:49524467-49524489 AGGGGCGGCTGCACCGGGACAGG + Intergenic
974386094 4:61202538-61202560 GGCGGCCGCGGCGCCGGGGCGGG + Intronic
975701255 4:77069132-77069154 CGGAGCCGCTGCGCCTGGCCAGG - Intronic
978617473 4:110611561-110611583 ACGCGCCGCTGCTCCGGGCCTGG - Intergenic
982690317 4:158540755-158540777 AGGTGTGGCTGCTGCGGGGCAGG - Intronic
984698150 4:182799666-182799688 AGGTGCAGGTGAGCCGGCGCCGG + Exonic
984734898 4:183099517-183099539 AGCTGCCGCTGCCCCGGGGCTGG + Exonic
985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG + Intergenic
985409196 4:189665081-189665103 AGGGGCTGCTGCGCACGGGCGGG - Intergenic
985660676 5:1155440-1155462 AGGTGACACCGAGCCGGGGCAGG - Intergenic
985896077 5:2750864-2750886 AAGTGCGTCTCCGCCGGGGCCGG - Intronic
994245631 5:97472140-97472162 AGGGGCCACTGCGATGGGGCTGG - Intergenic
998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
998838339 5:146226148-146226170 ATGAGCCACTGCGCCAGGGCTGG + Intronic
998936457 5:147234740-147234762 AGGTCCCGCCGCGCTTGGGCCGG - Intergenic
1002061981 5:176630510-176630532 AGCTGCCGCAGCGCCGGAGCCGG - Intronic
1002926844 6:1609979-1610001 AGGTGACGCGGGGCCCGGGCAGG + Exonic
1003078035 6:2999747-2999769 AGGCACCGCACCGCCGGGGCGGG + Intronic
1003099034 6:3163115-3163137 AGGGGCCGCGGCGCAGGGGGAGG + Intergenic
1013230513 6:108157790-108157812 TGGTGCGGCTGCGGCGGGGGCGG - Intronic
1013556207 6:111259575-111259597 AGGAGCCGCTGCCCCGCAGCCGG - Exonic
1015842992 6:137493285-137493307 AGGGGCCGCGGTGCCGGGCCGGG - Exonic
1016400725 6:143677810-143677832 GGGTGCGGGTGCGGCGGGGCCGG + Intronic
1019146434 6:169978180-169978202 GGGTGCAGCTGACCCGGGGCTGG - Intergenic
1019343828 7:520276-520298 AGCGGCCGGAGCGCCGGGGCGGG - Intronic
1019611762 7:1940254-1940276 CCCTGCCGCTGGGCCGGGGCAGG + Intronic
1019689645 7:2403556-2403578 AGGGGCTCCTGCGCCGGGGGCGG + Exonic
1019984036 7:4642132-4642154 GGGAGCTGCCGCGCCGGGGCCGG - Intergenic
1020105347 7:5420155-5420177 GGCGGGCGCTGCGCCGGGGCGGG - Intronic
1020162278 7:5781651-5781673 AGGTGACGCCGCGGCAGGGCCGG - Exonic
1021868185 7:24979582-24979604 AGGGGCCGCGGCGCAGGTGCGGG - Intronic
1022018573 7:26376694-26376716 AGGGGCGGCCGCGCCGGGGCCGG + Intergenic
1023966223 7:44964277-44964299 AGGAGCAGCTGGGCCTGGGCTGG + Intronic
1026840435 7:73667778-73667800 AGGAGCCGCGGCGCCGGGGCTGG - Intergenic
1029701385 7:102248793-102248815 AGCCGCCGCCGCGCCGGGGGAGG + Exonic
1029701453 7:102249042-102249064 AGGGGCCGCGGCCCTGGGGCGGG + Exonic
1030739047 7:113086524-113086546 CGGTGCCGCTGCGACAGGGGAGG - Intronic
1032195985 7:129788852-129788874 AGGAGCGGCTGAGCCAGGGCTGG + Intergenic
1033390642 7:140924596-140924618 AGAGGCCGCGGCGCCGGCGCCGG + Exonic
1034355911 7:150450757-150450779 AGGGGCTGGGGCGCCGGGGCCGG - Exonic
1034441025 7:151086260-151086282 AGGGGCCGGGGCGCCAGGGCTGG + Intronic
1035168800 7:157006621-157006643 AGGTTCGACTGCGCCTGGGCTGG + Exonic
1035463849 7:159063169-159063191 AGGTGCCGCGGAGCAGGGGGCGG + Intronic
1035598705 8:882267-882289 AGGTGCCGCTGGGCCAGGCACGG - Intergenic
1037676712 8:21057294-21057316 AGCTGCCACTGGGCCAGGGCAGG + Intergenic
1038328269 8:26588643-26588665 AGGTGCTGCTGCCGCAGGGCTGG + Intronic
1040459722 8:47635572-47635594 AGGTGCCACTGCGCCTGGCCAGG - Intronic
1045118740 8:99012972-99012994 TGGGGCCGCTGCGCCGGCGGCGG - Intergenic
1045847872 8:106658289-106658311 AGGTGTGCCTGGGCCGGGGCGGG + Intronic
1049266499 8:141670579-141670601 AGGAGCCTCTGCCTCGGGGCTGG - Intergenic
1049411351 8:142475347-142475369 AGGGGCCGCAGTGCCGGGGAAGG - Intronic
1049611890 8:143559686-143559708 AGGTCCCTCTGCCCTGGGGCTGG + Intronic
1049719589 8:144109500-144109522 TGGCGCCGGTGCGCCCGGGCTGG + Exonic
1053046426 9:34922985-34923007 GGGTGCTGCTGGGCCGGGCCTGG + Intergenic
1053424236 9:38000572-38000594 AGGTGGCGCTGTTCCGAGGCCGG + Intronic
1057646182 9:96877329-96877351 AGATGCCGCTGCGCAGGGACAGG + Intergenic
1059283089 9:113151163-113151185 CGCTGCCGCTGGCCCGGGGCTGG + Intronic
1059998343 9:119935342-119935364 AGGTGTTGGTGGGCCGGGGCGGG + Intergenic
1060180012 9:121527481-121527503 AGCTGCCGCTGCGCCTGGAAGGG - Intergenic
1060223984 9:121780415-121780437 GGGAGCCACTGTGCCGGGGCCGG - Intronic
1060479958 9:124012139-124012161 AGCTGCCCCTGCGCCTCGGCGGG + Exonic
1060481175 9:124017685-124017707 AGGTGCCGCCGCGCCTCGGAGGG - Intronic
1060757361 9:126223294-126223316 AGGCGCCGCAGCGCAGGGCCTGG + Intergenic
1061009852 9:127948458-127948480 AGGGGGCCCTGCGCCTGGGCAGG - Intronic
1061043781 9:128153695-128153717 AACTGCCGCTGCTCTGGGGCTGG - Intergenic
1061252695 9:129436024-129436046 AGGTTCAGCAGCGCTGGGGCAGG - Intergenic
1061449589 9:130661035-130661057 AGGGGTGGCTGGGCCGGGGCGGG - Intergenic
1061921223 9:133783584-133783606 AGGTGCCCCTGCACAGGGGAGGG + Exonic
1062425097 9:136502449-136502471 AAGTGCAGCTGCGCCGGCGGGGG + Exonic
1062607200 9:137353619-137353641 AGGTGCCTCTGCTCCTGGGCTGG - Intronic
1203697008 Un_GL000214v1:108744-108766 AGGGGTGGCTGCACCGGGGCAGG - Intergenic
1203552206 Un_KI270743v1:172285-172307 AGGGGCGGCTGCACCGGGGCAGG + Intergenic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1188483044 X:30653637-30653659 AAGAGGCGCTGAGCCGGGGCGGG + Intronic
1189512447 X:41676560-41676582 GGGCGCCGCTGGGCCGGGCCTGG + Intronic
1196085801 X:111681423-111681445 AGGTGCCGCTGCCCCTTAGCTGG + Intronic
1197782642 X:130172607-130172629 AGGTGCCGCTGCTCGGGGTAGGG - Intronic
1199094791 X:143726267-143726289 AGGTGCCGCGGAGCAGGGGGTGG + Intergenic
1199724338 X:150566606-150566628 AGGTGGGGCTGGGCTGGGGCTGG + Intergenic
1200173795 X:154097769-154097791 AGGTGCAGCAGCGCGCGGGCCGG - Intergenic
1201153487 Y:11107858-11107880 GGGGGCGGCTGCACCGGGGCAGG + Intergenic
1201416273 Y:13751872-13751894 AGCAGCAGCTGCTCCGGGGCCGG - Intergenic