ID: 1091229343

View in Genome Browser
Species Human (GRCh38)
Location 11:133977609-133977631
Sequence GCTTCAGACGGTGTTTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091229339_1091229343 -1 Left 1091229339 11:133977587-133977609 CCAAACTGCGATGCCGTGGGAGG No data
Right 1091229343 11:133977609-133977631 GCTTCAGACGGTGTTTCTTGTGG No data
1091229335_1091229343 23 Left 1091229335 11:133977563-133977585 CCTGAGCTAACACAGAATGAGAG No data
Right 1091229343 11:133977609-133977631 GCTTCAGACGGTGTTTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091229343 Original CRISPR GCTTCAGACGGTGTTTCTTG TGG Intergenic