ID: 1091229553

View in Genome Browser
Species Human (GRCh38)
Location 11:133979118-133979140
Sequence GAGTGAACCTCCTTGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091229549_1091229553 0 Left 1091229549 11:133979095-133979117 CCAGCATCAACTGCCAGCCACAT No data
Right 1091229553 11:133979118-133979140 GAGTGAACCTCCTTGGAAGCAGG No data
1091229548_1091229553 7 Left 1091229548 11:133979088-133979110 CCAAGTGCCAGCATCAACTGCCA No data
Right 1091229553 11:133979118-133979140 GAGTGAACCTCCTTGGAAGCAGG No data
1091229547_1091229553 25 Left 1091229547 11:133979070-133979092 CCTCACTGAGGACTCTTGCCAAG No data
Right 1091229553 11:133979118-133979140 GAGTGAACCTCCTTGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091229553 Original CRISPR GAGTGAACCTCCTTGGAAGC AGG Intergenic
No off target data available for this crispr