ID: 1091233693

View in Genome Browser
Species Human (GRCh38)
Location 11:134004965-134004987
Sequence ATCCAGCTCTGTCATCGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091233693_1091233698 28 Left 1091233693 11:134004965-134004987 CCTGCACGATGACAGAGCTGGAT No data
Right 1091233698 11:134005016-134005038 CAGCCTTACAGAAATGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091233693 Original CRISPR ATCCAGCTCTGTCATCGTGC AGG (reversed) Intergenic
No off target data available for this crispr