ID: 1091235172

View in Genome Browser
Species Human (GRCh38)
Location 11:134017128-134017150
Sequence TGCCTGCTCCCTCACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091235167_1091235172 16 Left 1091235167 11:134017089-134017111 CCTTCTTAAACACAAGGCAGGTG No data
Right 1091235172 11:134017128-134017150 TGCCTGCTCCCTCACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091235172 Original CRISPR TGCCTGCTCCCTCACAGTGA TGG Intergenic
No off target data available for this crispr