ID: 1091235692

View in Genome Browser
Species Human (GRCh38)
Location 11:134020745-134020767
Sequence CCTTGCTAGTTCCCGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091235692_1091235706 23 Left 1091235692 11:134020745-134020767 CCCACCCCCGGGAACTAGCAAGG No data
Right 1091235706 11:134020791-134020813 CTGTGCTCTCCTCCACCGCGGGG No data
1091235692_1091235707 28 Left 1091235692 11:134020745-134020767 CCCACCCCCGGGAACTAGCAAGG No data
Right 1091235707 11:134020796-134020818 CTCTCCTCCACCGCGGGGTTAGG No data
1091235692_1091235703 21 Left 1091235692 11:134020745-134020767 CCCACCCCCGGGAACTAGCAAGG No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data
1091235692_1091235705 22 Left 1091235692 11:134020745-134020767 CCCACCCCCGGGAACTAGCAAGG No data
Right 1091235705 11:134020790-134020812 CCTGTGCTCTCCTCCACCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091235692 Original CRISPR CCTTGCTAGTTCCCGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr