ID: 1091235696

View in Genome Browser
Species Human (GRCh38)
Location 11:134020750-134020772
Sequence GGAAGCCTTGCTAGTTCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091235696_1091235710 27 Left 1091235696 11:134020750-134020772 CCCCGGGAACTAGCAAGGCTTCC No data
Right 1091235710 11:134020800-134020822 CCTCCACCGCGGGGTTAGGAGGG No data
1091235696_1091235707 23 Left 1091235696 11:134020750-134020772 CCCCGGGAACTAGCAAGGCTTCC No data
Right 1091235707 11:134020796-134020818 CTCTCCTCCACCGCGGGGTTAGG No data
1091235696_1091235706 18 Left 1091235696 11:134020750-134020772 CCCCGGGAACTAGCAAGGCTTCC No data
Right 1091235706 11:134020791-134020813 CTGTGCTCTCCTCCACCGCGGGG No data
1091235696_1091235705 17 Left 1091235696 11:134020750-134020772 CCCCGGGAACTAGCAAGGCTTCC No data
Right 1091235705 11:134020790-134020812 CCTGTGCTCTCCTCCACCGCGGG No data
1091235696_1091235703 16 Left 1091235696 11:134020750-134020772 CCCCGGGAACTAGCAAGGCTTCC No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data
1091235696_1091235708 26 Left 1091235696 11:134020750-134020772 CCCCGGGAACTAGCAAGGCTTCC No data
Right 1091235708 11:134020799-134020821 TCCTCCACCGCGGGGTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091235696 Original CRISPR GGAAGCCTTGCTAGTTCCCG GGG (reversed) Intergenic
No off target data available for this crispr