ID: 1091235699

View in Genome Browser
Species Human (GRCh38)
Location 11:134020771-134020793
Sequence CAGGGAGGCTCAGGAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091235699_1091235706 -3 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235706 11:134020791-134020813 CTGTGCTCTCCTCCACCGCGGGG No data
1091235699_1091235705 -4 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235705 11:134020790-134020812 CCTGTGCTCTCCTCCACCGCGGG No data
1091235699_1091235703 -5 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data
1091235699_1091235707 2 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235707 11:134020796-134020818 CTCTCCTCCACCGCGGGGTTAGG No data
1091235699_1091235714 19 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235714 11:134020813-134020835 GTTAGGAGGGCGCCTCCGATGGG No data
1091235699_1091235713 18 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235713 11:134020812-134020834 GGTTAGGAGGGCGCCTCCGATGG No data
1091235699_1091235715 20 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235715 11:134020814-134020836 TTAGGAGGGCGCCTCCGATGGGG No data
1091235699_1091235716 21 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235716 11:134020815-134020837 TAGGAGGGCGCCTCCGATGGGGG No data
1091235699_1091235708 5 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235708 11:134020799-134020821 TCCTCCACCGCGGGGTTAGGAGG No data
1091235699_1091235710 6 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235710 11:134020800-134020822 CCTCCACCGCGGGGTTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091235699 Original CRISPR CAGGGAGGCTCAGGAGAAAC TGG (reversed) Intergenic
No off target data available for this crispr