ID: 1091235700

View in Genome Browser
Species Human (GRCh38)
Location 11:134020780-134020802
Sequence AGGAGAGCACAGGGAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091235700_1091235716 12 Left 1091235700 11:134020780-134020802 CCTGAGCCTCCCTGTGCTCTCCT No data
Right 1091235716 11:134020815-134020837 TAGGAGGGCGCCTCCGATGGGGG No data
1091235700_1091235710 -3 Left 1091235700 11:134020780-134020802 CCTGAGCCTCCCTGTGCTCTCCT No data
Right 1091235710 11:134020800-134020822 CCTCCACCGCGGGGTTAGGAGGG No data
1091235700_1091235714 10 Left 1091235700 11:134020780-134020802 CCTGAGCCTCCCTGTGCTCTCCT No data
Right 1091235714 11:134020813-134020835 GTTAGGAGGGCGCCTCCGATGGG No data
1091235700_1091235715 11 Left 1091235700 11:134020780-134020802 CCTGAGCCTCCCTGTGCTCTCCT No data
Right 1091235715 11:134020814-134020836 TTAGGAGGGCGCCTCCGATGGGG No data
1091235700_1091235708 -4 Left 1091235700 11:134020780-134020802 CCTGAGCCTCCCTGTGCTCTCCT No data
Right 1091235708 11:134020799-134020821 TCCTCCACCGCGGGGTTAGGAGG No data
1091235700_1091235713 9 Left 1091235700 11:134020780-134020802 CCTGAGCCTCCCTGTGCTCTCCT No data
Right 1091235713 11:134020812-134020834 GGTTAGGAGGGCGCCTCCGATGG No data
1091235700_1091235707 -7 Left 1091235700 11:134020780-134020802 CCTGAGCCTCCCTGTGCTCTCCT No data
Right 1091235707 11:134020796-134020818 CTCTCCTCCACCGCGGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091235700 Original CRISPR AGGAGAGCACAGGGAGGCTC AGG (reversed) Intergenic
No off target data available for this crispr