ID: 1091235703

View in Genome Browser
Species Human (GRCh38)
Location 11:134020789-134020811
Sequence CCCTGTGCTCTCCTCCACCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091235697_1091235703 15 Left 1091235697 11:134020751-134020773 CCCGGGAACTAGCAAGGCTTCCA No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data
1091235698_1091235703 14 Left 1091235698 11:134020752-134020774 CCGGGAACTAGCAAGGCTTCCAG No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data
1091235696_1091235703 16 Left 1091235696 11:134020750-134020772 CCCCGGGAACTAGCAAGGCTTCC No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data
1091235695_1091235703 17 Left 1091235695 11:134020749-134020771 CCCCCGGGAACTAGCAAGGCTTC No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data
1091235694_1091235703 20 Left 1091235694 11:134020746-134020768 CCACCCCCGGGAACTAGCAAGGC No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data
1091235691_1091235703 22 Left 1091235691 11:134020744-134020766 CCCCACCCCCGGGAACTAGCAAG No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data
1091235699_1091235703 -5 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data
1091235692_1091235703 21 Left 1091235692 11:134020745-134020767 CCCACCCCCGGGAACTAGCAAGG No data
Right 1091235703 11:134020789-134020811 CCCTGTGCTCTCCTCCACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091235703 Original CRISPR CCCTGTGCTCTCCTCCACCG CGG Intergenic
No off target data available for this crispr