ID: 1091235710

View in Genome Browser
Species Human (GRCh38)
Location 11:134020800-134020822
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091235697_1091235710 26 Left 1091235697 11:134020751-134020773 CCCGGGAACTAGCAAGGCTTCCA No data
Right 1091235710 11:134020800-134020822 CCTCCACCGCGGGGTTAGGAGGG No data
1091235701_1091235710 -9 Left 1091235701 11:134020786-134020808 CCTCCCTGTGCTCTCCTCCACCG No data
Right 1091235710 11:134020800-134020822 CCTCCACCGCGGGGTTAGGAGGG No data
1091235696_1091235710 27 Left 1091235696 11:134020750-134020772 CCCCGGGAACTAGCAAGGCTTCC No data
Right 1091235710 11:134020800-134020822 CCTCCACCGCGGGGTTAGGAGGG No data
1091235698_1091235710 25 Left 1091235698 11:134020752-134020774 CCGGGAACTAGCAAGGCTTCCAG No data
Right 1091235710 11:134020800-134020822 CCTCCACCGCGGGGTTAGGAGGG No data
1091235700_1091235710 -3 Left 1091235700 11:134020780-134020802 CCTGAGCCTCCCTGTGCTCTCCT No data
Right 1091235710 11:134020800-134020822 CCTCCACCGCGGGGTTAGGAGGG No data
1091235695_1091235710 28 Left 1091235695 11:134020749-134020771 CCCCCGGGAACTAGCAAGGCTTC No data
Right 1091235710 11:134020800-134020822 CCTCCACCGCGGGGTTAGGAGGG No data
1091235699_1091235710 6 Left 1091235699 11:134020771-134020793 CCAGTTTCTCCTGAGCCTCCCTG No data
Right 1091235710 11:134020800-134020822 CCTCCACCGCGGGGTTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091235710 Original CRISPR CCTCCACCGCGGGGTTAGGA GGG Intergenic
No off target data available for this crispr