ID: 1091238086

View in Genome Browser
Species Human (GRCh38)
Location 11:134034826-134034848
Sequence CTCAATGCTTCAAGCCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091238086_1091238090 2 Left 1091238086 11:134034826-134034848 CCACCATGGCTTGAAGCATTGAG No data
Right 1091238090 11:134034851-134034873 CTCTGGACTAGATAAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091238086 Original CRISPR CTCAATGCTTCAAGCCATGG TGG (reversed) Intergenic
No off target data available for this crispr