ID: 1091238090

View in Genome Browser
Species Human (GRCh38)
Location 11:134034851-134034873
Sequence CTCTGGACTAGATAAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091238085_1091238090 6 Left 1091238085 11:134034822-134034844 CCAGCCACCATGGCTTGAAGCAT No data
Right 1091238090 11:134034851-134034873 CTCTGGACTAGATAAAAATGTGG No data
1091238083_1091238090 11 Left 1091238083 11:134034817-134034839 CCCTACCAGCCACCATGGCTTGA No data
Right 1091238090 11:134034851-134034873 CTCTGGACTAGATAAAAATGTGG No data
1091238078_1091238090 30 Left 1091238078 11:134034798-134034820 CCTTCAGGGCTACCCTAACCCCT No data
Right 1091238090 11:134034851-134034873 CTCTGGACTAGATAAAAATGTGG No data
1091238088_1091238090 -1 Left 1091238088 11:134034829-134034851 CCATGGCTTGAAGCATTGAGGTC No data
Right 1091238090 11:134034851-134034873 CTCTGGACTAGATAAAAATGTGG No data
1091238080_1091238090 17 Left 1091238080 11:134034811-134034833 CCTAACCCCTACCAGCCACCATG No data
Right 1091238090 11:134034851-134034873 CTCTGGACTAGATAAAAATGTGG No data
1091238086_1091238090 2 Left 1091238086 11:134034826-134034848 CCACCATGGCTTGAAGCATTGAG No data
Right 1091238090 11:134034851-134034873 CTCTGGACTAGATAAAAATGTGG No data
1091238084_1091238090 10 Left 1091238084 11:134034818-134034840 CCTACCAGCCACCATGGCTTGAA No data
Right 1091238090 11:134034851-134034873 CTCTGGACTAGATAAAAATGTGG No data
1091238082_1091238090 12 Left 1091238082 11:134034816-134034838 CCCCTACCAGCCACCATGGCTTG No data
Right 1091238090 11:134034851-134034873 CTCTGGACTAGATAAAAATGTGG No data
1091238079_1091238090 18 Left 1091238079 11:134034810-134034832 CCCTAACCCCTACCAGCCACCAT No data
Right 1091238090 11:134034851-134034873 CTCTGGACTAGATAAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091238090 Original CRISPR CTCTGGACTAGATAAAAATG TGG Intergenic
No off target data available for this crispr