ID: 1091239936

View in Genome Browser
Species Human (GRCh38)
Location 11:134045662-134045684
Sequence TAGATTATGTAGGACTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091239936_1091239951 30 Left 1091239936 11:134045662-134045684 CCCCCCAAGTCCTACATAATCTA No data
Right 1091239951 11:134045715-134045737 TGGGAATAGGCAAGAAGGTGTGG No data
1091239936_1091239944 11 Left 1091239936 11:134045662-134045684 CCCCCCAAGTCCTACATAATCTA No data
Right 1091239944 11:134045696-134045718 AAAAAGTGTCCCAACCCTCTGGG No data
1091239936_1091239949 25 Left 1091239936 11:134045662-134045684 CCCCCCAAGTCCTACATAATCTA No data
Right 1091239949 11:134045710-134045732 CCCTCTGGGAATAGGCAAGAAGG No data
1091239936_1091239943 10 Left 1091239936 11:134045662-134045684 CCCCCCAAGTCCTACATAATCTA No data
Right 1091239943 11:134045695-134045717 CAAAAAGTGTCCCAACCCTCTGG No data
1091239936_1091239945 17 Left 1091239936 11:134045662-134045684 CCCCCCAAGTCCTACATAATCTA No data
Right 1091239945 11:134045702-134045724 TGTCCCAACCCTCTGGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091239936 Original CRISPR TAGATTATGTAGGACTTGGG GGG (reversed) Intergenic
No off target data available for this crispr