ID: 1091241195

View in Genome Browser
Species Human (GRCh38)
Location 11:134053601-134053623
Sequence GCCCAGAGCAGAAAGCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091241191_1091241195 7 Left 1091241191 11:134053571-134053593 CCAATCTGGGAAGCGTGCAGAGA No data
Right 1091241195 11:134053601-134053623 GCCCAGAGCAGAAAGCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091241195 Original CRISPR GCCCAGAGCAGAAAGCTTGC AGG Intergenic
No off target data available for this crispr