ID: 1091243204

View in Genome Browser
Species Human (GRCh38)
Location 11:134069042-134069064
Sequence AAGCCGCGCCGCGCTGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091243200_1091243204 11 Left 1091243200 11:134069008-134069030 CCTGGCAGGCTGGGCGCATGCGC 0: 1
1: 0
2: 0
3: 25
4: 212
Right 1091243204 11:134069042-134069064 AAGCCGCGCCGCGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091243204 Original CRISPR AAGCCGCGCCGCGCTGCCGC TGG Exonic