ID: 1091249114

View in Genome Browser
Species Human (GRCh38)
Location 11:134127103-134127125
Sequence ATAGGAAGAAGAAGAATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 765
Summary {0: 1, 1: 0, 2: 8, 3: 56, 4: 700}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091249112_1091249114 10 Left 1091249112 11:134127070-134127092 CCAAAGCGTGTAGTTAATCTCTT 0: 1
1: 0
2: 0
3: 7
4: 193
Right 1091249114 11:134127103-134127125 ATAGGAAGAAGAAGAATTGTAGG 0: 1
1: 0
2: 8
3: 56
4: 700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091249114 Original CRISPR ATAGGAAGAAGAAGAATTGT AGG Intronic
900758341 1:4453501-4453523 ATAGGAAGAAGAAGTTCTGAGGG + Intergenic
901530798 1:9851333-9851355 AAAAGAAAAAGAAGGATTGTGGG - Intronic
903749153 1:25609266-25609288 ATAGGAAAGAGAAGAAATATTGG - Intergenic
904183923 1:28687896-28687918 ATAGGAAGAAGAATAGTTTGAGG + Intronic
904797841 1:33070769-33070791 ATAGGAAGAAGAAGAAGAAGAGG + Intronic
905773852 1:40655314-40655336 ATAGGAAGCAGAAGAACTGTAGG + Intronic
906186743 1:43868001-43868023 ATATTAAGAAGTGGAATTGTTGG - Intronic
906936760 1:50220903-50220925 ATTGAAAGAAATAGAATTGTTGG - Intergenic
907643849 1:56220894-56220916 ATAGGAATAAAAAAAATTCTTGG + Intergenic
907758211 1:57331743-57331765 AAAAGAAGAAGAGCAATTGTGGG - Intronic
908125876 1:61029830-61029852 AAAAGAAGAAGAAGAAGTATGGG + Intronic
908410604 1:63860787-63860809 AAAAGAAGAAGAAGAATGGAAGG + Intronic
909662027 1:78094655-78094677 TAAGGAAGACGAAGAATGGTTGG + Intronic
909963891 1:81883132-81883154 ATTGGAAGAGAAAGAATTTTGGG + Intronic
910604061 1:89064149-89064171 ATAGAAAGAGGAGGAATAGTAGG + Intronic
910679146 1:89844228-89844250 AGAGGAAGAAGATGAGTTGTGGG + Intronic
910856790 1:91703949-91703971 AAAGGAAGATGAAGGATTTTAGG - Intronic
911385891 1:97175071-97175093 ATACCTAGAAGTAGAATTGTTGG + Intronic
911644683 1:100325816-100325838 TTATGAAGAAGAAGAAGTATGGG + Intergenic
911741434 1:101390220-101390242 ACAGGGAGCAGAAGAAGTGTGGG + Intergenic
912723447 1:112039208-112039230 AGAGGAAGAAGATGAGTTGGTGG - Intergenic
912800603 1:112717494-112717516 GTATGAAGAAGCAGACTTGTGGG + Intergenic
913457749 1:119050886-119050908 ATAGGAAGGGAAAGAATTGAAGG + Intronic
914748758 1:150518225-150518247 ATGGGAAGAAGAATAGTTGGAGG - Intergenic
915237199 1:154492582-154492604 CAAGGAAGAAGAAAAACTGTAGG - Intronic
916060421 1:161094585-161094607 AAAAGAAAAAGAAAAATTGTAGG + Intergenic
917047025 1:170872375-170872397 ATAGGAAGCAGAAGACCAGTTGG + Intergenic
917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG + Intronic
917629356 1:176877591-176877613 AGAGGAAGAAGAGGAATTCTAGG + Intronic
917794577 1:178523657-178523679 ATAGGGAAAAGAAGAAGGGTGGG + Intronic
917830044 1:178873015-178873037 TGAGGAAAAAGAAGAATGGTGGG + Intronic
918104146 1:181401981-181402003 AGAAGAAGTAGAAGAAATGTAGG + Intergenic
918433083 1:184482449-184482471 GTAGAAAGAGGAGGAATTGTTGG + Intronic
919176759 1:194028656-194028678 AGAGGAAGAAGAAGAAGAGGAGG - Intergenic
919331274 1:196175307-196175329 TTAGAAACAAGAAGAATTGCAGG + Intergenic
920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG + Intergenic
920839516 1:209542380-209542402 ATAGTAAGAAGCAGAATGATTGG - Intergenic
921352845 1:214255449-214255471 AAAGGAGGAAGAAGAAATGGTGG - Intergenic
921528812 1:216253633-216253655 AATGGAAGAAGCAGAAGTGTAGG - Intronic
921684047 1:218069801-218069823 AAAGGAAGATTAAGGATTGTTGG - Intergenic
922198720 1:223382805-223382827 ATAGGAAAAGGAAGAAATGGAGG + Intergenic
923415357 1:233752014-233752036 ATACCGAGAAGTAGAATTGTTGG + Intergenic
923792552 1:237124674-237124696 AGAAGAAGCAGAAGACTTGTGGG - Intronic
923867302 1:237953467-237953489 TTAGGAAGAAGAGGCAATGTAGG + Intergenic
924190712 1:241549373-241549395 AAAGAAAGAAAAAGAATTGCAGG + Intronic
924902636 1:248418058-248418080 ACAGGAAGCAGAAAAATTCTGGG + Intergenic
1062868228 10:875862-875884 ATAAGAAGGACATGAATTGTGGG - Intronic
1062938533 10:1405304-1405326 ATTGGAAGGAGAGTAATTGTAGG - Intronic
1062958757 10:1557552-1557574 TTAGGAAGGTGAAGAACTGTTGG - Intronic
1063233211 10:4086506-4086528 CTAGGAAGGAGAAGGTTTGTGGG - Intergenic
1063692850 10:8303783-8303805 ATAAGAAGAAGAAGAAGAGGAGG - Intergenic
1063749710 10:8929494-8929516 AAAGGAAGAAGAAGAAATATAGG - Intergenic
1063794982 10:9503574-9503596 ACACTAAGAAAAAGAATTGTGGG - Intergenic
1063802736 10:9599044-9599066 AGAGGAAGAAGAGGAAGGGTTGG - Intergenic
1064460580 10:15531418-15531440 ATAGGAAGAAGATAAATGGATGG - Intronic
1065389325 10:25166642-25166664 AAAGGAAGAAAAAGAATAGAAGG + Intergenic
1065550714 10:26866037-26866059 AAAAAAAGAAGAAGAATTGCAGG + Intergenic
1065690836 10:28331919-28331941 ATACCAAGGAGATGAATTGTAGG - Intronic
1065785718 10:29212395-29212417 GTAGGATGAAAGAGAATTGTAGG - Intergenic
1065905594 10:30248437-30248459 AGAGGAAGAAGAAGAAGAGAAGG + Intergenic
1066333244 10:34447965-34447987 ATATGCAGAAGCAGAATTGCTGG - Intronic
1067063200 10:43088791-43088813 TTAGGAAGAAGAAGAAGGTTGGG - Intronic
1067413537 10:46085831-46085853 ATACCTAGAAGCAGAATTGTGGG + Intergenic
1067980808 10:51082338-51082360 ATAGGAAGCAGAAGGACTCTGGG + Intronic
1068633150 10:59319176-59319198 ATAGAAAGAGGAAGTTTTGTTGG - Intronic
1068835230 10:61545452-61545474 AGAGGAAGAAGAAGAAAAGGAGG + Intergenic
1068836037 10:61555025-61555047 AGAAGAAGAAGAAGTACTGTAGG - Intergenic
1069069976 10:63983159-63983181 GTAGGAAGAAGTTGTATTGTGGG + Intergenic
1070515011 10:77196585-77196607 ATAGGAGGAAAAAGGACTGTGGG + Intronic
1070653191 10:78252801-78252823 ATTGGGATAAGAGGAATTGTGGG + Intergenic
1071153494 10:82663508-82663530 AAAGGAGGAAGGAGAATTCTAGG + Intronic
1071235086 10:83636217-83636239 AGAGGAGGAAGAAGAATGGTTGG + Intergenic
1071964124 10:90834884-90834906 GTAGGAACAGGAAGAATTGGGGG + Intronic
1072531032 10:96319534-96319556 ATAGAAAGAAGAAGGATAGAAGG - Intronic
1072534205 10:96348375-96348397 AAAGAAAGAAGAAGAAGTGAAGG + Intronic
1072785791 10:98280905-98280927 ATAATAAAAAGAAGAAATGTTGG - Intergenic
1073953257 10:108836028-108836050 AAAGGAAGAAGAAGAGAGGTTGG + Intergenic
1074666890 10:115737761-115737783 TTAGAAAGAAGCAGAATTGGGGG - Intronic
1078370932 11:10744540-10744562 ATTTGAATAAGCAGAATTGTGGG - Intergenic
1078829066 11:14961683-14961705 ATGGGAAGAAGAAGAAAAGCTGG + Intronic
1078848038 11:15139468-15139490 ATAAGAAGCAGTAGAATTGTTGG + Intronic
1079071934 11:17354530-17354552 AAAAAAAGAAGAAGAATTGGGGG - Intronic
1079657974 11:23005135-23005157 AAAAGAAAAAGAAAAATTGTTGG + Intergenic
1080223253 11:29931609-29931631 ATAACCAGAAGTAGAATTGTTGG - Intergenic
1080793215 11:35539550-35539572 AAAGGATGAAGAAGAATTGATGG + Intergenic
1081040574 11:38205371-38205393 AAAAGAAGAAGAAGAATAGAGGG + Intergenic
1081064971 11:38530695-38530717 AAAAGAAGAAGAAGAAGTGAGGG - Intergenic
1081074277 11:38649940-38649962 ATAAGAAGAAGAAGAAGAGGAGG + Intergenic
1081084235 11:38779337-38779359 AGAGGAAGAGGAAGAGTCGTTGG + Intergenic
1081446880 11:43139280-43139302 CTAGGAAGAACATGAATTTTTGG - Intergenic
1082669778 11:56020747-56020769 ATAGGAAGAAGAAGAAGAATAGG + Intergenic
1085013605 11:73158124-73158146 TTTGGAAGAAGAAGAAGTATGGG + Intergenic
1085059550 11:73432285-73432307 ATACCAAGTAGTAGAATTGTTGG + Intronic
1085160973 11:74344685-74344707 ATAGCAAGAAGAAGTATAATGGG - Intronic
1085627093 11:78081852-78081874 AGAGGAAGAAGAAGGAATGGAGG - Intergenic
1085824948 11:79836039-79836061 ATAGAAAATAGAAGAAATGTGGG + Intergenic
1085840160 11:80002347-80002369 AAAAAAAGAAGAAGAAGTGTAGG - Intergenic
1086336852 11:85809775-85809797 CTAGGAAGGAGAAGAGGTGTGGG - Intronic
1086734166 11:90285251-90285273 AAAAGAAGAAGAAGAAAGGTTGG - Intergenic
1086864029 11:91958547-91958569 ATAGGAAGAAAAACAATTCAAGG + Intergenic
1087578358 11:100019699-100019721 ATACTCAGAAGTAGAATTGTTGG + Intronic
1088047628 11:105472837-105472859 AGAGGAAGAAGAAGAAGGGGAGG + Intergenic
1088567263 11:111185044-111185066 GTAGAAAGAAGGATAATTGTTGG + Intergenic
1089646031 11:119879759-119879781 ATAAGAATAAGAATAAATGTAGG + Intergenic
1090166912 11:124559253-124559275 AGATGAAGAAGAAGACTTGAAGG - Intergenic
1090310326 11:125730885-125730907 AGAGGAAGATGAAGACGTGTGGG + Intergenic
1090491843 11:127170317-127170339 AAAGGAAGAAGAAGAGGAGTTGG + Intergenic
1090739669 11:129646068-129646090 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
1091036124 11:132235542-132235564 AGAGGAAGAAAAAGAAAAGTAGG - Intronic
1091249114 11:134127103-134127125 ATAGGAAGAAGAAGAATTGTAGG + Intronic
1091785635 12:3241993-3242015 AGAGGAAAAGGAAGAATTCTCGG - Intronic
1092633722 12:10416400-10416422 ATTGGAAGAAGAAGAGTCTTGGG - Intronic
1092635808 12:10447272-10447294 ATTGGAAGAAGAAGAGTCTTGGG - Intronic
1093058171 12:14575639-14575661 ACAGTAAGAAGAACAATTGTAGG + Intergenic
1093314914 12:17637473-17637495 ATACCCAGAAGAAGAATTGCTGG + Intergenic
1093505934 12:19865686-19865708 AGTGGAAGAACAAGAAGTGTGGG + Intergenic
1093846002 12:23972321-23972343 ATAGGAAGAAAAATATTTTTAGG - Intergenic
1094019667 12:25900908-25900930 AAAGGAAGGAGAAGAATGGCGGG + Intergenic
1094569837 12:31632041-31632063 AAAAGAAGAAGAAGAAATGCTGG - Intergenic
1095251828 12:39988589-39988611 AGAGGAAGAAGAAGAAGACTAGG + Intronic
1095648278 12:44576117-44576139 AAAGGAAGCGGAAGATTTGTTGG - Intronic
1095748220 12:45683054-45683076 ATAGCCAGAAGTAGAATTGGTGG - Intergenic
1095927649 12:47595004-47595026 ATAGAAAGATGGAGAATTGTTGG + Intergenic
1096268123 12:50141042-50141064 AAAGAAGGAAGAAGAATTTTAGG - Intronic
1096338635 12:50777812-50777834 AAAGGAAGAAGAAAATATGTAGG + Intronic
1096519525 12:52176461-52176483 AGAAGAAGAAGAAGAAGTGATGG - Intronic
1096830484 12:54310049-54310071 ATATGGAGAAGCTGAATTGTTGG - Intronic
1096991114 12:55804352-55804374 ATAGGAGGAAGGAGAATTGATGG + Intronic
1097265218 12:57740386-57740408 AGAGGGTGAAGGAGAATTGTTGG + Intronic
1097714355 12:62950468-62950490 AGAGGAAGAAGAAGAAGAGGAGG - Intergenic
1097714365 12:62950516-62950538 AGAGGAAGAAGAAGAAGAGGAGG - Intergenic
1098217305 12:68234118-68234140 GGAGGAGGAAGAAGAAATGTGGG + Intergenic
1098594669 12:72257893-72257915 ATAGGAGCAAGAAAAATTGCTGG + Intronic
1098826398 12:75303003-75303025 ATACTTAGAAGTAGAATTGTTGG - Intronic
1098949740 12:76627579-76627601 GTAGGTAGAAGAAGAATGTTGGG + Intergenic
1099300160 12:80883172-80883194 ATAGGAGAAAGAGGAATTGGAGG - Intronic
1099421668 12:82469435-82469457 ATAGGAAGGAGAAGAATGACAGG + Intronic
1099595373 12:84656025-84656047 ATACGAAGAACAAGAGTTTTAGG - Intergenic
1099868815 12:88320381-88320403 ACAGGGAGAAGGAGAACTGTTGG + Intergenic
1099926260 12:89021454-89021476 CTAGAAACTAGAAGAATTGTTGG + Intergenic
1100779418 12:98008095-98008117 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
1101158512 12:101950692-101950714 ATTGGAAGAAGAAGAATTGGTGG + Intronic
1101282744 12:103276329-103276351 CTAGGAAGAATAATAATTATGGG - Intronic
1102019689 12:109673660-109673682 AAATGAAGAAGCAGAAATGTTGG - Intergenic
1103288065 12:119819570-119819592 ACAAGAAAAAGAAGAATTGGGGG + Intronic
1103312986 12:120026960-120026982 ATAGAAAGAATATGAATTATTGG + Intronic
1103404559 12:120666219-120666241 AAAGGAAGAAGAAGAAGGGAGGG + Intronic
1103465172 12:121136620-121136642 AAAGAAAGAAAAGGAATTGTAGG - Intronic
1104496264 12:129242720-129242742 AAAAGAAGAAGAAAAATTGAAGG - Intronic
1104657780 12:130586460-130586482 ATAAGAAGAAGAAGAAGAGATGG + Intronic
1105543336 13:21333775-21333797 ATAGGAAGAAATAGACTTGAAGG + Intergenic
1105588678 13:21770054-21770076 ATAGGTAGAAATAGAATTTTAGG + Intergenic
1106347600 13:28894259-28894281 ATAAGAAGAAGGAGAGTTGGTGG + Intronic
1106389968 13:29325555-29325577 AGAGGAAGAAGAAGAAGAGGAGG + Intronic
1106602265 13:31198522-31198544 ATGGGAGGAAAAAGAAATGTAGG - Intergenic
1106754213 13:32806160-32806182 ATATCAAGAAGATGACTTGTTGG + Intergenic
1106799227 13:33239387-33239409 ATACTAAGAAGTAGAATTGCTGG + Intronic
1107063896 13:36191385-36191407 ATGGGAAGAAGCAGAGTAGTAGG + Intronic
1107183743 13:37493166-37493188 ATACTATGAAGAAAAATTGTAGG - Intergenic
1107507627 13:41050517-41050539 ATATCAAGAAGCAGAATTGCTGG + Intronic
1107905738 13:45059478-45059500 AGGGGAAAATGAAGAATTGTAGG - Intergenic
1108602901 13:52010150-52010172 ATAGGAGTATGAAGAAATGTTGG - Intronic
1108988087 13:56619632-56619654 ATAGGAAAAAAACAAATTGTTGG - Intergenic
1109148023 13:58807279-58807301 AGAGGAAGAAGAAGAAATAAGGG - Intergenic
1109693853 13:65928014-65928036 ATAGGCAGGAAAAGAATTGAAGG + Intergenic
1109805487 13:67435235-67435257 CTAGGAATAAGACAAATTGTTGG + Intergenic
1110073135 13:71204463-71204485 AGAGGAAGAAGAGTAATGGTAGG + Intergenic
1110736123 13:78938785-78938807 ATATGAGGAAGAAGATTTGGGGG - Intergenic
1111358093 13:87137593-87137615 ACAGCAAGAACAATAATTGTGGG + Intergenic
1112793195 13:103026958-103026980 AAAGGAATAAGAAAAATTATGGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114347902 14:21816251-21816273 ATGGCAAAAAGAAGAATTTTTGG + Intergenic
1114401710 14:22416256-22416278 GTAACAAAAAGAAGAATTGTAGG - Intergenic
1115219673 14:31046861-31046883 AAAAGAAGAAGTAGAATTGCTGG + Intronic
1115271376 14:31557220-31557242 ATGGCAAGAAGATGAATTCTTGG - Intronic
1115430018 14:33306533-33306555 TTAGCAGGAAGATGAATTGTGGG + Intronic
1116779097 14:49216117-49216139 AGGGGAAGGAGAAGTATTGTAGG - Intergenic
1117098946 14:52325711-52325733 TAAGGAAAAAGAAGAATTGATGG - Intronic
1117387879 14:55234732-55234754 AGAGGAAGAAGAAGAAGAGGAGG - Intergenic
1117963302 14:61183215-61183237 AGAGGAAGAATGAGAATAGTTGG - Intergenic
1118560477 14:67075037-67075059 ATAGGAAGAAGATGCCTTCTAGG + Intronic
1118569816 14:67183143-67183165 ATAAGAAGAACAACAATTATAGG + Intergenic
1118695288 14:68378984-68379006 ATTGGATGAAGAAGCATTGTTGG - Intronic
1118866264 14:69706165-69706187 ATAGGATGAAGAGGATTTGAAGG + Intronic
1119766491 14:77192825-77192847 AGAGGAAGAAGAAGAAGAGGAGG + Intronic
1119808328 14:77497386-77497408 AAAGGAAGAAGAAGAATGGCTGG + Intronic
1119947569 14:78711011-78711033 AAAAGAAGAAGAAGAAGTATGGG - Intronic
1120052662 14:79885431-79885453 GTAAGCAGAAGAAGAATTGCTGG - Intergenic
1120095178 14:80380386-80380408 AGAAGAAGAAGAAGAAGTTTCGG + Intronic
1120526375 14:85581403-85581425 AAAGAAAGGAAAAGAATTGTTGG + Intronic
1120939030 14:89928167-89928189 CTAGGAAGTACAAGATTTGTGGG + Intronic
1122512858 14:102284032-102284054 TTAGGAAGTGCAAGAATTGTAGG - Intronic
1124418560 15:29495055-29495077 ATACCCAGAAGTAGAATTGTTGG + Intronic
1125104587 15:35955679-35955701 ATAGGAAGATGAATAATTTGGGG - Intergenic
1125202387 15:37111374-37111396 AAAAGAAGAGGAAGAAATGTGGG - Intergenic
1125927547 15:43575473-43575495 AAAGGAAGACAAAGAATTGATGG - Intronic
1125940690 15:43675038-43675060 AAAGGAAGACAAAGAATTGATGG - Intergenic
1125983209 15:44023002-44023024 ATTTGAAGGAGAAGAAATGTTGG + Intronic
1126277568 15:46902140-46902162 AGAGGAAGAAGAATAATTTTGGG - Intergenic
1126309579 15:47300531-47300553 ATAAGTAGAAAAAGGATTGTAGG - Intronic
1127045347 15:55019467-55019489 ATAAGAAGAAGAAGAACAATGGG + Intergenic
1127145413 15:56018370-56018392 ACAGGAAGAAGAAGAATAGGTGG - Intergenic
1127249622 15:57218501-57218523 AAAGGAAAAATAAGAAGTGTGGG - Intronic
1127494494 15:59497139-59497161 AGAAGAAGAAGAAGAAATTTAGG + Intronic
1127749182 15:62016157-62016179 AGAAGAGGAAGAAGAATGGTAGG - Intronic
1127923306 15:63512301-63512323 AGAGGAAGAAGAAGAAGAGGAGG - Intronic
1128266471 15:66271068-66271090 ATAGGAAGAAGAAGAAGAAGAGG + Intergenic
1129485626 15:75868983-75869005 AGAGGAAGAAGAAGAAGAGATGG + Exonic
1129618152 15:77116771-77116793 ATAGGTAGTAGAAGACTTGAAGG - Intronic
1130644578 15:85712846-85712868 ACAGGAATAAGAATATTTGTGGG - Intronic
1130943642 15:88533412-88533434 ATACCCAGAAGTAGAATTGTTGG - Intronic
1131644487 15:94327185-94327207 ATAGAAAAGAGAAGAAATGTAGG - Intronic
1131974041 15:97924245-97924267 ATTGCAAGAAGAAGAAGTTTTGG + Intergenic
1132755551 16:1482806-1482828 ATAGGAAGAGGGAGAATGGGAGG + Intergenic
1133204798 16:4226873-4226895 ATAGGAAGAAGATGAATGGAAGG + Intronic
1133586671 16:7202457-7202479 ATATCCAGAATAAGAATTGTTGG - Intronic
1133858257 16:9570051-9570073 ATAGGAATGAGAACATTTGTAGG - Intergenic
1133874795 16:9723464-9723486 ATAGGAAGAAGGAGAAGAGGAGG + Intergenic
1134774101 16:16837056-16837078 ATAGGAAGTAGAAAGATGGTTGG + Intergenic
1135330189 16:21554270-21554292 AAAAGAAGAAGAAGAATTCTGGG - Intergenic
1135395277 16:22126592-22126614 ATAGGAAGAAGAGGAAAGGAAGG + Intronic
1136554655 16:31000884-31000906 CCAGGAAGGAAAAGAATTGTGGG - Intronic
1137095853 16:36255594-36255616 ATAAAAAGAAGAAGCATTCTCGG - Intergenic
1137374699 16:47942626-47942648 AAAGGAAGAAGAAGAAGAGGAGG - Intergenic
1137755092 16:50894813-50894835 ATATGAAGGAGTAGAATTGCGGG - Intergenic
1137889228 16:52140984-52141006 TTATGAAAAAGAAAAATTGTTGG - Intergenic
1137991592 16:53162230-53162252 AGAGGGAGATGAAGAATAGTAGG + Intronic
1138142337 16:54579545-54579567 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
1138264166 16:55647539-55647561 AAAGGAAGAAGAAGAAACGGAGG + Intergenic
1138911201 16:61401290-61401312 ATATGAAGAAGAAGAAAAGAAGG + Intergenic
1140344752 16:74202359-74202381 ATAGTAAAAACAAGAATTGATGG + Intergenic
1140869214 16:79091183-79091205 ATAGGAAGAGGAAAAAGTCTGGG - Intronic
1141210180 16:81972395-81972417 ACAGGAAGAAGAAGAGAAGTGGG - Intergenic
1143130022 17:4672143-4672165 AGAGGAAGAAGAAGAAGAGGAGG - Exonic
1143305925 17:5946717-5946739 CTAGGAAGAAGAGGATTTGATGG + Intronic
1143482569 17:7236140-7236162 AGAGGAAGAAGAAGAAGAGATGG - Exonic
1143593937 17:7902947-7902969 ACAGGAGGAAGCAGAATTGTTGG - Exonic
1143663670 17:8343509-8343531 ATTCCAAGAAGAAGCATTGTAGG + Intronic
1143694612 17:8603035-8603057 ACAGTATGAGGAAGAATTGTTGG - Intronic
1143930351 17:10416464-10416486 ATACTCAGAAGTAGAATTGTGGG + Intronic
1144409428 17:14986132-14986154 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
1144544865 17:16184694-16184716 ATATCCAGAAGAAGGATTGTGGG - Intronic
1145094447 17:20013213-20013235 ATACCCAGAAGTAGAATTGTTGG + Intronic
1146083989 17:29810115-29810137 AAAGAAAGAACAAGTATTGTAGG + Intronic
1147395730 17:40140947-40140969 AAGGGAAGAAGAAGGATTGGGGG + Intronic
1147498814 17:40942541-40942563 ATAAGAAGAAGAAGAAGAGAAGG - Intergenic
1147797889 17:43058414-43058436 AAAGAAAGAAAAAGAATTGCTGG + Intronic
1148187157 17:45652793-45652815 ATAGGGAGTAGAAGAAATGGAGG - Intergenic
1148271465 17:46265420-46265442 AGAGGAAGAGGAAGAAGAGTAGG - Intergenic
1149098757 17:52877269-52877291 AATGGAAGAAGAAAACTTGTTGG + Intronic
1149222052 17:54426327-54426349 ATAGGAATAAGAACAACTTTTGG + Intergenic
1149273280 17:55006399-55006421 AGAGGAAGAAGAAAAATCTTTGG - Intronic
1149502573 17:57165369-57165391 TGAGGAGGAAGAAGAATGGTAGG + Intergenic
1149687928 17:58548951-58548973 AAAAAAAGAAGAAGAAATGTAGG + Intergenic
1150051390 17:61967805-61967827 ATAGGAGGAAGAAACATTGAGGG - Intronic
1150374566 17:64670003-64670025 AGAAGAAGAAGAAGAAATGGGGG - Intergenic
1150381219 17:64721424-64721446 ATAGCCAGAAGTGGAATTGTTGG - Intergenic
1150596029 17:66605576-66605598 ATACCTAGAAGAGGAATTGTTGG - Intronic
1150964170 17:69948470-69948492 ATAAGAAGAAGAAGAAGAGGAGG + Intergenic
1151052650 17:70995971-70995993 AAAGGAAGAAGAGGAATAGGAGG - Intergenic
1151106432 17:71621343-71621365 AGAGGAAGAAGTAGAGGTGTTGG + Intergenic
1151242126 17:72766330-72766352 ATACTTAGAAGAAGAATTGCTGG + Intronic
1151393933 17:73807362-73807384 ATATGTAGAAGTAGAATTGTTGG - Intergenic
1151413228 17:73944844-73944866 AGAGGAAGAAAAAGAAGTGGGGG - Intergenic
1152297546 17:79476932-79476954 AGAGGAAGAAGAAGAAAAGGAGG + Intronic
1153106365 18:1532789-1532811 ATAGGAAGAATAAGAATAAATGG - Intergenic
1153274704 18:3356760-3356782 ATACCCAGAAGAAGCATTGTTGG - Intergenic
1153385092 18:4484174-4484196 ATAGAAAACAGAAGGATTGTAGG + Intergenic
1153622473 18:6991688-6991710 ATATTAAGAAGTAGAATTATTGG - Intronic
1153795014 18:8613731-8613753 AGAGTAAGAATAAGAAATGTGGG + Intronic
1154466259 18:14644383-14644405 AAAGGAAGAAGAACAGGTGTGGG - Intergenic
1155102441 18:22625497-22625519 ATAGATAGAAGAAGATTAGTAGG - Intergenic
1155576159 18:27249290-27249312 AAAGGAAAAAGAGGAATTATTGG - Intergenic
1155632839 18:27914611-27914633 ATATCTACAAGAAGAATTGTGGG - Intergenic
1155690652 18:28618316-28618338 ACAGGATGGAGAAGAATTCTTGG + Intergenic
1155998129 18:32353836-32353858 ATAGGAAGAAGGAGAAGAGAAGG + Intronic
1156181848 18:34613922-34613944 ATAGGAAGAAGATGCCTTCTAGG + Intronic
1156247525 18:35316270-35316292 ATATCAAGAAGTAGAATTGCTGG - Intergenic
1156400709 18:36736866-36736888 ATAGGAAGCAGAGAAATTCTAGG - Intronic
1156689723 18:39692946-39692968 AAAGAAAGAAGAAGAATGTTAGG - Intergenic
1157266580 18:46228976-46228998 AAAGGAAGAAAAAGAAGTTTTGG + Intronic
1157474571 18:48013081-48013103 ATAGCTAGGAGTAGAATTGTGGG + Intergenic
1159079777 18:63724163-63724185 AGAGGAAGAAGAAGAAGAGGAGG - Intronic
1159402461 18:67955681-67955703 ATAGGAGGAAGAAGAAGAGGAGG + Intergenic
1159577174 18:70193422-70193444 ATAAGACAAAGAAGAATTTTGGG + Exonic
1161225468 19:3142903-3142925 AAAGGAAGAAGAAGATCTGAGGG + Intronic
1161308606 19:3581105-3581127 AGAAGAAGAAGAAGCAGTGTGGG - Intergenic
1161624502 19:5318348-5318370 AAAAGAAGAAGAAGAAATGATGG + Intronic
1161635130 19:5383702-5383724 AGAGGAAGAAGAAGAAGAGGAGG - Intergenic
1161659123 19:5535245-5535267 ATATGAAGATGAAGGAATGTAGG - Intergenic
1162173208 19:8807732-8807754 ATAGGAAAAAAAAGCATTTTAGG - Exonic
1162300384 19:9841715-9841737 AGAGCAAGAAGAAGAAGTGGAGG + Intronic
1162425801 19:10594689-10594711 AGAAGAAGAAGAAGAAGAGTGGG - Intergenic
1162873473 19:13603191-13603213 AGAGGGAGAAGAAGAAGAGTTGG + Intronic
1164471011 19:28532529-28532551 ATACCTAGAAGTAGAATTGTTGG - Intergenic
1164588471 19:29492804-29492826 AGAGGAAAAAGAAGAATTTTCGG + Intergenic
1164701139 19:30285441-30285463 AAAAGAAGAAAAAAAATTGTTGG + Intronic
1164818586 19:31226210-31226232 ATGGGAAGAAGTGGAATTGAAGG - Intergenic
1165548085 19:36559260-36559282 ATAGCCAGAAGCAGAATTGCTGG - Intronic
1165706730 19:37981583-37981605 ATAGGAATAATAATAATTGCCGG - Intronic
1166197781 19:41218382-41218404 ATGGGAATAAGAATAGTTGTTGG - Intergenic
1167153913 19:47726489-47726511 AGAGGAAGAAGAAGAAGAGAAGG - Intronic
926043297 2:9691773-9691795 AAAAGAAGAAGAAAAATTGGAGG - Intergenic
926203931 2:10821520-10821542 CTAGAAAGAGGAAGCATTGTTGG + Intronic
927290044 2:21396206-21396228 ATAGTAAGATGAAGACTTCTAGG - Intergenic
927615262 2:24587521-24587543 CAAGGAACAAGAAGAATTTTGGG - Intronic
928383056 2:30837650-30837672 ATAGGCAGAAGTGAAATTGTTGG - Intergenic
928605871 2:32945016-32945038 ATAAGATGACAAAGAATTGTGGG + Intergenic
929053273 2:37855784-37855806 AAAGGAAGGAAAAGAAATGTTGG + Intergenic
929119534 2:38473003-38473025 ATAGGAAGAAGGATAATTTCAGG + Intergenic
929367330 2:41175687-41175709 ATAGGAAGAAGAGGAAGAGGAGG + Intergenic
929695733 2:44113662-44113684 AAAAGTAGAAGAACAATTGTAGG - Intergenic
929855559 2:45635929-45635951 AAAAGAAGAAGAAGAAGGGTGGG + Intergenic
930396935 2:50833669-50833691 ACAGCAAGAGGAAGTATTGTTGG + Intronic
930582923 2:53233977-53233999 ATAGCAGGAAGAAGACTTCTGGG + Intergenic
931062225 2:58543894-58543916 ATAGAAAGTTGCAGAATTGTAGG + Intergenic
931153536 2:59601817-59601839 ATACACAGAAGAAGAATTGCTGG + Intergenic
931485483 2:62686394-62686416 ATAGGGAGAGGAAGAAGTGCAGG - Intronic
931490771 2:62744302-62744324 ATAGGAAGTTGTATAATTGTAGG + Intronic
932059853 2:68485319-68485341 ATCGGAAAAACAAAAATTGTGGG - Intronic
932383872 2:71312686-71312708 AGAGGAGGAAGAAGAAAGGTTGG + Intronic
932448286 2:71793957-71793979 CTAGGAAGAAGAAGCAAGGTGGG - Intergenic
933437959 2:82272914-82272936 ATAAGCAGAAGGGGAATTGTTGG - Intergenic
933591138 2:84233862-84233884 ATGGGAAGAATCAGAATTCTGGG - Intergenic
935130214 2:100256189-100256211 TTAGGAAAAAGCAGTATTGTAGG + Intergenic
935738510 2:106126131-106126153 ATAGGAGGAAGAAGAATGAGTGG - Intronic
935946089 2:108288027-108288049 CAAGGAGGAAGAAGAAGTGTCGG + Intergenic
936683970 2:114805742-114805764 ATAGGAAGCAGCAGAATTTGAGG - Intronic
937404029 2:121610971-121610993 ATAGGAGGAAGAGGAACTGGAGG + Intronic
937404045 2:121611055-121611077 ACAGGAGGAAGAAGAACTGGAGG + Intronic
937404133 2:121611493-121611515 ACAGGAAGAAGAGGAACTGGAGG + Intronic
937404174 2:121611700-121611722 ACAGGAGGAAGAAGAACTGGAGG + Intronic
937511221 2:122597205-122597227 AGAGGAAGAAGATGAAATGCAGG + Intergenic
937662039 2:124442090-124442112 ATTATAAGGAGAAGAATTGTTGG + Intronic
938309150 2:130275186-130275208 ATAGGCCGAAGAAGTGTTGTGGG - Intergenic
938317688 2:130341489-130341511 ATAGGAAGTAGAGAAATTGTTGG - Intronic
938811553 2:134858011-134858033 ATAGCCAGAAGTAGAATTGCTGG - Intronic
939445334 2:142302931-142302953 GTAGGAAGAAGAGGCAATGTAGG - Intergenic
939734529 2:145827460-145827482 AAAGGAAGAAGAAGAAGAGGAGG - Intergenic
939941241 2:148354013-148354035 TCAGGAAGAAGAAGAGTTGAAGG - Intronic
940326760 2:152433764-152433786 ATAAGAAGAAAAGGAAATGTTGG - Intronic
940390063 2:153122282-153122304 AAATGATGAAGAAGAATTATTGG + Intergenic
940549423 2:155134054-155134076 ATAGCTAGAAGTGGAATTGTTGG - Intergenic
940570443 2:155426215-155426237 ATAGCATAAATAAGAATTGTAGG - Intergenic
940865398 2:158812842-158812864 ATTGGAAGAAGTGGAATTGCTGG - Intronic
941171326 2:162140845-162140867 AAAACAAGAAGAAGAAATGTAGG - Intergenic
941948396 2:171126253-171126275 ATATGATGAAGAAAAATTTTAGG + Intronic
942516330 2:176757387-176757409 AGAGGAGGAAGAGGAATGGTTGG + Intergenic
942566536 2:177269692-177269714 ATAAGAAGAAGAAAAAAGGTGGG + Intronic
943901601 2:193445566-193445588 GGAGGAAGAAGAAGAAAGGTTGG + Intergenic
944184395 2:196930791-196930813 AGAGAAGGAAGAAGAAATGTAGG - Intergenic
944452428 2:199856747-199856769 ATAGGATAAAGAAAACTTGTAGG - Intergenic
944508720 2:200443233-200443255 AGAGGAAGAAAATGAATTTTAGG + Intronic
945093810 2:206200427-206200449 AAAGAAAGAAAAAGAATGGTGGG + Intronic
945622755 2:212162070-212162092 ATACCAAGAAGTAGAATTGCTGG - Intronic
945640863 2:212427888-212427910 AGAGGAAGAAGAGGGATTGAGGG + Intronic
945683506 2:212940855-212940877 TGATGAAGAAAAAGAATTGTGGG + Intergenic
946330104 2:219004178-219004200 AGAGGAAGAAGAAGAGTTGGAGG - Exonic
946605135 2:221395988-221396010 TTAGGAAGAGGAAGAATTGTGGG + Intergenic
946606062 2:221406641-221406663 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
947128898 2:226901393-226901415 ATATGCAGAAGTAGAATTGCTGG + Intronic
947587132 2:231363331-231363353 ATACCCAGAAGAAGAATTGGTGG + Intronic
947723875 2:232385209-232385231 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
947772738 2:232683631-232683653 ATAGGAAGGAGCAGGATTGCTGG - Intergenic
948377019 2:237527759-237527781 ATACCAAGAAGTGGAATTGTTGG - Intronic
1169949175 20:11024072-11024094 ATACGTAGGAGTAGAATTGTTGG + Intergenic
1169967884 20:11237618-11237640 ATAGAAAGTAGAGGAATTCTGGG + Intergenic
1170269411 20:14507431-14507453 TTGGGAAGAAGAAGAATTTCTGG + Intronic
1170302383 20:14898863-14898885 ATAGGAAGTAGTATCATTGTTGG + Intronic
1171088880 20:22265600-22265622 TTAGGTAGAGGAAGAATTGCTGG + Intergenic
1171884925 20:30645050-30645072 ACAGGAAGATGAAGAAATTTTGG - Intergenic
1172708284 20:36899653-36899675 GTGGGAAGAAAAAGAATTGCAGG + Intronic
1173144720 20:40514728-40514750 ATAGGAAGAGGCAGAAGTGAGGG + Intergenic
1173497184 20:43528209-43528231 ATAGGAAGAAGTGGAAGGGTTGG - Intronic
1173778596 20:45734377-45734399 AAAGGAACAAGTAAAATTGTTGG + Intergenic
1174001268 20:47376549-47376571 AAAAGAAGAAGAAGAAATCTAGG + Intergenic
1174329705 20:49808418-49808440 ATAGGAAAAATAAGATCTGTTGG - Intergenic
1174680824 20:52406583-52406605 AAAAGAAGAAGAAGACGTGTGGG - Intergenic
1174972334 20:55290182-55290204 ATAAGAAGAAGAAGAAGAGGTGG - Intergenic
1175512980 20:59547160-59547182 ATAGAAATAAGAAAAATGGTGGG + Intergenic
1176136819 20:63526697-63526719 AAAGGAAGAAGGAAATTTGTTGG + Intergenic
1176659666 21:9622514-9622536 GAAGGAAGAAGAAGAAATATTGG + Intergenic
1176808330 21:13514219-13514241 AAAGGAAGAAGAACAGGTGTGGG + Intergenic
1177046965 21:16182950-16182972 ATAAAAAGAAGAAGAATAGGAGG - Intergenic
1177107595 21:16979048-16979070 ATAATAAGTAGAAGAATAGTAGG - Intergenic
1177873917 21:26608007-26608029 TTAGGAAGAAGGAAAAGTGTGGG + Intergenic
1177938740 21:27382595-27382617 AGAGGAAGAAGACGTATTCTTGG - Intergenic
1178270089 21:31181732-31181754 AGAAGAAGAAGAAGAAGTGCTGG - Intronic
1178726444 21:35056734-35056756 AAAGGAAAAAAAAGAATTATAGG - Intronic
1178767491 21:35468000-35468022 ATAGGAAGAAGAAAAAGAGGAGG - Intronic
1179081795 21:38178494-38178516 AGAGGAAGAAGAAGAAGAGGAGG + Intronic
1179474666 21:41635511-41635533 ACAGGATGAGAAAGAATTGTTGG - Intergenic
1179504736 21:41832967-41832989 ATTGGAGGGAGAAGCATTGTTGG - Intronic
1181515525 22:23409531-23409553 AGAAGAAGAAGAAGATTTGGGGG - Intergenic
1181977245 22:26738557-26738579 AGAGGAAGAAGAAGAAGAGGAGG - Intergenic
1181992279 22:26846656-26846678 AAGGGAAGAAGAAAACTTGTTGG + Intergenic
1182020396 22:27076676-27076698 AAAGGAGGAAGAAGAAGAGTTGG + Intergenic
1182914103 22:34012174-34012196 ATAGAAGGAAGGAGAATCGTAGG + Intergenic
1183897288 22:40979443-40979465 ATATCGAGAAGTAGAATTGTTGG + Intergenic
1184762409 22:46551965-46551987 AGAGGAAGAAGAAGAAAGGCAGG - Intergenic
1184989894 22:48160257-48160279 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
949264191 3:2138048-2138070 AAAAGAAGAAGAAGAATATTGGG - Intronic
949460057 3:4281798-4281820 ACAGAAAGAAGAAGAAAAGTGGG + Intronic
949751339 3:7355807-7355829 ATAGCAGGAATAAGAACTGTGGG - Intronic
951111833 3:18812965-18812987 GCAGGAAGAGGAGGAATTGTTGG - Intergenic
951941998 3:28089438-28089460 AAAGGAAGAAAGAGAATTGAAGG - Intergenic
952084559 3:29801996-29802018 AAAGGAAGAAAAAGAGATGTTGG - Intronic
952213884 3:31256243-31256265 GTAGGGAGAAGAAGAATTGGAGG - Intergenic
952562881 3:34616252-34616274 AGAGGAAGCAGAAGAATTCAAGG - Intergenic
952998154 3:38905123-38905145 TTGGGAAGAAGAAGAATGGAAGG + Intronic
953327648 3:42026245-42026267 ATAGAAAGTATAAGAAATGTGGG + Intronic
954835793 3:53466634-53466656 ATATGTAGAAGTAGAATTGCTGG + Intergenic
954948751 3:54450320-54450342 ATAGGAAGGATATGAATTTTTGG - Intronic
955166407 3:56518586-56518608 AAAGAAAGAAAAAGAAATGTGGG + Intergenic
955505005 3:59623546-59623568 ATAGAAAGAAGAATATTTGAAGG + Intergenic
955537356 3:59938434-59938456 ATAGTAAGCAGCAGATTTGTAGG + Intronic
955567131 3:60259410-60259432 AAAGGAAGAAGATGAGTAGTGGG + Intronic
955595301 3:60583586-60583608 ATAGAAAGAAGAATAATAATTGG - Intronic
955897939 3:63720727-63720749 ATAGCAAGAAGAGGAAAGGTGGG + Intergenic
956019777 3:64921870-64921892 GTAGGTAGAAGAAGAATGGATGG + Intergenic
956169341 3:66420446-66420468 ATATGCAGAAGTGGAATTGTGGG - Intronic
957072030 3:75574963-75574985 ACAGGAAGGAGATGAATTGGAGG - Intergenic
957644594 3:82904403-82904425 TTAGGAAAAAGAAGATTTCTTGG + Intergenic
957762633 3:84578143-84578165 AAAGGAAGAAGAAGAAGAGGAGG + Intergenic
957866891 3:86037296-86037318 ATAAGCACAAGAAGAAATGTTGG + Intronic
957917096 3:86699140-86699162 ATAGGAAGATAGAGAATTGGGGG - Intergenic
958032903 3:88134909-88134931 ATAGGTAGAAGAAGTAGTTTGGG + Intronic
958042950 3:88247691-88247713 TTAGGAAGAAGCAGAATTCAGGG + Intergenic
958253494 3:91297276-91297298 ATATGAAGTAGAAGACATGTAGG + Intergenic
958746799 3:98145637-98145659 ATAGCAAGAAAAAAAATTGATGG - Intergenic
958781076 3:98543215-98543237 ATAAGAATAAGATGAATTTTGGG + Intronic
958810472 3:98855441-98855463 ATACGTAGAAGAGGAATTGCTGG - Intronic
959054887 3:101557672-101557694 AAAGGAAGAGGATGAATTATAGG - Intergenic
959090509 3:101897720-101897742 ATACCTAGAAGAAGAATTGCTGG + Intergenic
959299507 3:104579448-104579470 AGATGGAGATGAAGAATTGTTGG - Intergenic
959732540 3:109620449-109620471 ACAGGGAGGAGAAGAACTGTAGG - Intergenic
959871135 3:111329894-111329916 ATGAGAAGAAGAAGAAGTCTGGG - Intronic
959922670 3:111885554-111885576 ATGGGAAGAAGAAGGATAGCAGG - Intronic
960751232 3:120956685-120956707 ATATCCAGAAGAAGAATTGCTGG + Intronic
961132788 3:124484357-124484379 TGAGGAAGGAGAAGAATTGCAGG - Intronic
961608635 3:128118100-128118122 TTAGGAAGAAGAAAAATGGAGGG + Intronic
962717587 3:138140155-138140177 ACAGGAAAAAGAAAAAATGTAGG - Intergenic
962843711 3:139257359-139257381 ATACGCAGAAGTAGAATTGCTGG + Intronic
963184442 3:142397694-142397716 AGAGGAAGAAGAAGATAAGTTGG + Intronic
965218660 3:165898146-165898168 AGAGGAAGAAGAAGAAGAGGAGG - Intergenic
965346337 3:167555552-167555574 AAAGGAAGAAGCAGACTTGTGGG + Intronic
965848862 3:172997143-172997165 ATACCAAGGAGAACAATTGTTGG + Intronic
966230827 3:177649557-177649579 AGAGGAATAAGGAGAATTTTTGG + Intergenic
966356932 3:179090517-179090539 ATTGGAAGAAGAATTGTTGTGGG - Intergenic
966402290 3:179560675-179560697 ATTGGAAGAAGAAATATTTTGGG + Intergenic
966963388 3:184964946-184964968 ATACCCAGAAGTAGAATTGTTGG + Intronic
967012416 3:185448608-185448630 ATAGGAAAAAGTAGAAATGTGGG + Intronic
967205856 3:187120599-187120621 ATAGGGAGAACAAGTATTTTAGG - Intergenic
967845771 3:194041464-194041486 ATAGGCAGTAGAAGTATTGAAGG + Intergenic
968178819 3:196574892-196574914 ATAGGAAGAATCAGATTTGGAGG + Intronic
968321866 3:197776625-197776647 ATAGAAAGCAGGAGAATAGTGGG + Intronic
970114072 4:12673372-12673394 AAAGGAAGAGAAAGAATTGTTGG - Intergenic
970932152 4:21524679-21524701 ATAGGAAGAAAAAGATTAGATGG - Intronic
971104794 4:23512529-23512551 CTAGGAAGATGAAAAATTTTTGG - Intergenic
971271848 4:25157191-25157213 ATAGGGAGAAAAAGAATTGATGG - Intronic
972025251 4:34367964-34367986 ATACCAAGGAGTAGAATTGTTGG - Intergenic
972154981 4:36149010-36149032 ATAGTAAGAATAAGAAATTTGGG - Intronic
972180701 4:36461948-36461970 ATAGAAGGAAGAACAATTTTTGG - Intergenic
972228637 4:37044215-37044237 ATAGGAAAAAGAAAAAGTGTGGG - Intergenic
972549289 4:40113002-40113024 AAAGGAAGATAAAGAATTTTCGG - Intronic
972958542 4:44422664-44422686 ATAGGAAGAAGAGGAGTTTGGGG + Intronic
973627028 4:52783145-52783167 GTAGGAGAAAGAAGAACTGTTGG - Intergenic
973824643 4:54693010-54693032 ATAGAAAGAAGAGCACTTGTGGG - Intronic
974704522 4:65494953-65494975 AGAGGAAGAAGAAGAAGAGGAGG + Intronic
975128626 4:70810058-70810080 AAAAGAAGAAAAAGAATTATTGG + Intergenic
975247405 4:72135710-72135732 ATAGGAAGAAAAATACTTATAGG - Intronic
976041772 4:80894670-80894692 ATATGCAGAAGTCGAATTGTTGG - Intronic
976067476 4:81205115-81205137 ATAGGAATGAGAGGAATGGTGGG - Intronic
976280678 4:83324095-83324117 AAAAGAAGAAGAAGAAGTATTGG - Intronic
976954535 4:90879567-90879589 AGAGGAAGAAGAAGAAGAGGAGG + Intronic
977009469 4:91618555-91618577 AAAGGGAGAAGAAGAGTGGTTGG + Intergenic
977235400 4:94502075-94502097 AAAGGAAGCAGAAGAAGAGTAGG - Intronic
977366201 4:96071203-96071225 ATAGGAACAAGAAGCAATGTTGG - Intergenic
978905100 4:113996150-113996172 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
978908079 4:114032830-114032852 ATAGGGAGAGAAAGAATTGGTGG - Intergenic
979867583 4:125775983-125776005 AGATGGAGATGAAGAATTGTTGG + Intergenic
980100459 4:128536631-128536653 ATGGCAAGTAGAAGAAATGTTGG + Intergenic
980312247 4:131146528-131146550 ATTGCTAGAAGTAGAATTGTTGG + Intergenic
980517872 4:133888378-133888400 ATAGGAAGAAAAAGGATTTGTGG + Intergenic
980687499 4:136248578-136248600 ATATTAAGAAGAAGAATTTCTGG - Intergenic
980708910 4:136538684-136538706 ATAGTAAAAAGCAGAATTCTAGG + Intergenic
980768496 4:137339961-137339983 ATAGGAAAGAGAAGAATGGACGG - Intergenic
982094335 4:151907632-151907654 GTAGGAAGAACAGGAATTATTGG - Intergenic
982297288 4:153842391-153842413 ATATGTAGAAGCAGAATTGCTGG + Intergenic
982424202 4:155237881-155237903 ATAGGAAGAAGAATAAATCGGGG - Intergenic
982539666 4:156652346-156652368 ATACCAAGAAGTGGAATTGTTGG - Intergenic
982976267 4:162066293-162066315 AGAAGAAGAAGAAGAAAAGTAGG - Intronic
983196351 4:164811109-164811131 AGAAGAAGAAGAAGAAGTGGAGG + Intergenic
983422289 4:167534318-167534340 ATAGGAAAACAAAGAATTGTTGG - Intergenic
983723273 4:170885844-170885866 AGAGGAAGAGGAAGAATAGAAGG - Intergenic
983942098 4:173545075-173545097 ATAAGAACAACAAGAAATGTTGG - Intergenic
983983766 4:174032341-174032363 GTAGGAAAAAAAAGAGTTGTAGG + Intergenic
984467892 4:180124630-180124652 ATTGGGGGAAGAAGTATTGTAGG - Intergenic
985147622 4:186909821-186909843 ATAGGAAGAAAAAGAACAGATGG + Intergenic
985415704 4:189733901-189733923 GAAGGAAGAAGAAGAAATATTGG - Intergenic
986488129 5:8261093-8261115 AAAGGAACAAGAATAAATGTGGG + Intergenic
986526778 5:8687247-8687269 ATAGGCAGAAGAAATATTTTTGG - Intergenic
987758984 5:22134368-22134390 TTAAGAAGTAGAAGAACTGTGGG - Intronic
987977610 5:25034584-25034606 ATAGGCATAAGAATAAATGTGGG - Intergenic
988563427 5:32301078-32301100 AAAGAAAGAAAAAGATTTGTAGG + Intronic
988892381 5:35631589-35631611 ATATCTAGAAGTAGAATTGTTGG - Intronic
989039460 5:37211994-37212016 AAAGGAAGAAGAAAAAATATGGG + Intronic
989264500 5:39457502-39457524 AGAAGAAGTAGAAGCATTGTGGG - Intronic
989268709 5:39506767-39506789 AAAGGAAGAAGAAGAGTTGGAGG - Intergenic
989299579 5:39874319-39874341 TTAGGAAGAAGAATCAATGTTGG - Intergenic
989553289 5:42760834-42760856 AAAGGAATAAGAAGCATTTTTGG + Intronic
989686244 5:44090462-44090484 CAAGGAAGAAGAAGAATAGTGGG - Intergenic
990010738 5:50994535-50994557 ATATCAAGAAGCAGAATTGAAGG + Intergenic
990661566 5:58021401-58021423 ATAAAAAGGAGATGAATTGTTGG + Intergenic
991893690 5:71367815-71367837 TTAAGAAGTAGAAGAACTGTGGG - Intergenic
992120998 5:73592083-73592105 ATAGGGAGATGAAGAAAGGTTGG - Intergenic
992426835 5:76666504-76666526 ATGGGAAGAAGAAAAAGTGCAGG + Intronic
992737893 5:79742170-79742192 AAAGGAAGAAGAAGAAGAGGAGG - Intronic
992867218 5:80969797-80969819 AAAAGAAGAAGAAGTATTATTGG - Intronic
992873207 5:81026194-81026216 ATAGGAGGAAGAAGAAAGGAAGG - Intronic
992951043 5:81858119-81858141 ATAAGAAAAAGAAAAATTGAAGG + Intergenic
993248384 5:85482609-85482631 ATATGAAGAAATAGAATTATTGG - Intergenic
994753601 5:103767992-103768014 ATATGAAAAAGAAAAATTCTGGG + Intergenic
994952711 5:106484992-106485014 ATAGTTAGAAGTAGAATTATGGG + Intergenic
994985519 5:106928081-106928103 ATAAGAGGAAGAAGAAATGTTGG - Intergenic
995238211 5:109855136-109855158 ATAGGAAGAAGAAAAGAAGTCGG + Exonic
995543889 5:113210653-113210675 ATAGGAAGAAGGAGAATCCAAGG + Intronic
995568073 5:113452275-113452297 ATAGGAATGGGAAGAATTGTGGG + Intronic
995758234 5:115535589-115535611 AGAAGAAGAAGAACAAGTGTTGG + Intronic
995879395 5:116827039-116827061 ACCAGAAGAAGAAGAAATGTTGG + Intergenic
995966229 5:117910904-117910926 ATAGACAGAGGAAGAAATGTGGG - Intergenic
996105817 5:119501295-119501317 AAAGGAAGAAGAAGAAGGGGAGG - Intronic
996132799 5:119802283-119802305 ATAGAGAGTAGAAGAATGGTTGG - Intergenic
996232953 5:121088415-121088437 ATAGGAAGAGGAAGCATGGGTGG + Intergenic
996517313 5:124385913-124385935 ATAGAAATAAAAAGGATTGTGGG + Intergenic
996625007 5:125560258-125560280 AAAGGAAGAAGAGGCATTTTTGG + Intergenic
997291538 5:132739585-132739607 ATATGTAGAAGTAGAATTGCTGG + Intergenic
997314834 5:132923788-132923810 ATAGTAAAAAGTAGAATTGCTGG - Intronic
997721958 5:136085486-136085508 AAAGGAAGAAGTAGAATTGTTGG + Intergenic
997781687 5:136666101-136666123 TTAGGAAGAAGTAGAATTGTGGG + Intergenic
997835503 5:137189251-137189273 ATTGGAAGAAGAAGCCATGTTGG + Intronic
998330176 5:141318768-141318790 ATAGGCAGAAAAATGATTGTAGG - Exonic
998680776 5:144464707-144464729 ATAGGAAGAAGAAGAAGAAGAGG - Intronic
1000327975 5:160186770-160186792 AGAGGAACAAGAAGAGTTGTGGG + Intergenic
1000405289 5:160881421-160881443 ATACCAAGAAGCACAATTGTTGG - Intergenic
1000664288 5:163975631-163975653 AGAGGAGGATGAGGAATTGTTGG - Intergenic
1001457642 5:171877267-171877289 ACAGGAAGAAGGAGGCTTGTTGG + Intronic
1002262279 5:178002302-178002324 AAAGGAAGAAGAAGAAAGGAAGG - Intergenic
1002519845 5:179786298-179786320 AAAGGAAGAAGAAGAAGAGGAGG + Intronic
1002880066 6:1243133-1243155 GTAGGAAAGAGAAGACTTGTTGG - Intergenic
1003132751 6:3409564-3409586 ATAAGGAGAAGAAGAGTTTTAGG - Intronic
1003467489 6:6394753-6394775 AGAGGAAGAGGAAAAATGGTTGG + Intergenic
1003593067 6:7452258-7452280 AGAAGAAGAAGAAGAAGAGTGGG - Intergenic
1003616823 6:7662006-7662028 ATACCAAGAAGTGGAATTGTTGG + Intergenic
1003835973 6:10073029-10073051 ATAGGAAGAGGATCAAGTGTAGG + Intronic
1004029957 6:11858427-11858449 ATAGGTAGAAGTTGAATTGATGG - Intergenic
1004100984 6:12611144-12611166 ATAGGTAGGAGAGGAATTGCTGG - Intergenic
1004117968 6:12789725-12789747 AAAGAAAGAAAAAGAATAGTAGG - Intronic
1004245389 6:13970598-13970620 ATACCAAGTAGAAGAATTGCTGG + Intronic
1005290325 6:24373219-24373241 GTACAAAGTAGAAGAATTGTTGG - Intergenic
1006170770 6:32090963-32090985 ATAGGGAGAAGGAGAACTCTGGG - Intronic
1007732726 6:43958662-43958684 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
1008110887 6:47493162-47493184 ATATGAAGAAGAAGCATAGAAGG - Intronic
1008428718 6:51389539-51389561 ATAGGAATAAGAGTCATTGTAGG + Intergenic
1008440584 6:51527791-51527813 AGAAGAAGAAGAAGAAGTGAAGG - Intergenic
1008939852 6:57034920-57034942 ATAATAAGAAGAAGAAATTTTGG - Intergenic
1009190978 6:60629761-60629783 ATATGAAGTAGAAGATATGTAGG - Intergenic
1009283755 6:61785649-61785671 ATAGGAAGATGAAGAAGTATTGG + Intronic
1009483299 6:64188638-64188660 AGGGCAAGAAGAAAAATTGTTGG - Intronic
1009698910 6:67148896-67148918 AAAGGAGGAAGAAGAACTGAGGG - Intergenic
1010878081 6:81134053-81134075 AGAGGAAGAGAAGGAATTGTTGG - Intergenic
1011224451 6:85091552-85091574 AAAGGAAGAACAAAAATTCTAGG - Intergenic
1011629392 6:89309759-89309781 ATAAGAAGAAGAAGAAGCATGGG - Intronic
1011796356 6:90957535-90957557 AAATGAAGCAGAAGAAATGTTGG + Intergenic
1012542463 6:100377462-100377484 TTAGGAAGAGTTAGAATTGTGGG + Intergenic
1012946829 6:105475217-105475239 ATAGGAAGATGAAAAATTTCTGG - Intergenic
1013845012 6:114439666-114439688 ATATAAAAAACAAGAATTGTTGG + Intergenic
1014072228 6:117196057-117196079 ATAGGAAGGAGAAGAAGGGGAGG - Intergenic
1014123810 6:117754371-117754393 AAGGGAAGAAGAAGAGATGTTGG + Intergenic
1014442675 6:121491560-121491582 ATAGGGAAAAGCAGAATGGTGGG + Intergenic
1014697288 6:124639199-124639221 ATACCCAGTAGAAGAATTGTTGG - Intronic
1014730270 6:125024224-125024246 AGAGGAAGCAGAAGAAAAGTCGG + Intronic
1014832249 6:126116461-126116483 ATGGGAAGAAGAAGAGATGGAGG - Intergenic
1016487577 6:144559091-144559113 AAAATAAGAAGAAGAATTGGAGG - Intronic
1016593226 6:145769152-145769174 ATACCAAGGAGAAGAGTTGTTGG + Intergenic
1016984336 6:149883934-149883956 AGTGGAGGAAGAAGAGTTGTTGG - Intronic
1017484791 6:154892538-154892560 AGAGGAAGAAGGAGAAGTGGTGG - Intronic
1017559122 6:155607776-155607798 ATAGGAAGAAGAGGATTTGCAGG - Intergenic
1017834686 6:158167072-158167094 TTGGGAAGAAGAAGACTTGGAGG + Intronic
1019396924 7:825664-825686 AGAGGAAGAAAAACAACTGTTGG - Intronic
1020962480 7:14822672-14822694 ATAGAGAAAATAAGAATTGTAGG + Intronic
1021308823 7:19066281-19066303 AAAGTAAGATGAGGAATTGTTGG + Intronic
1021315957 7:19147021-19147043 AAAAGAAGAAGAAGAATTAAAGG - Intergenic
1021629075 7:22625839-22625861 ATTGGTAGAAGTAGAATTGCTGG + Intronic
1021795477 7:24249885-24249907 AAAGGAAGAAAAAGAATAGAGGG + Intergenic
1022256159 7:28660719-28660741 ATGGGAAGAAGAAGAAAGGGAGG - Intronic
1022492248 7:30830049-30830071 AAAGGAAGGAGAAGTCTTGTGGG + Intronic
1023105576 7:36760366-36760388 ATAGGCAGAAGAAAAATTGTTGG - Intergenic
1023151014 7:37201554-37201576 GTAGGAACTAGAAGCATTGTTGG - Intronic
1023358743 7:39394661-39394683 ATAGAAAAAAGAATAATTATGGG - Intronic
1024872329 7:53979908-53979930 AAAGGAAGAAAAGGAATAGTAGG - Intergenic
1025971497 7:66330311-66330333 ATGGGAAGCAGAATAAGTGTAGG + Intronic
1026144713 7:67736622-67736644 ATAGGAAGATGAACAATTTCAGG + Intergenic
1026154142 7:67812558-67812580 AGAGGAAGAAGAAGAAGAGGAGG - Intergenic
1027150354 7:75729170-75729192 AAAAAAAGAAGAAGCATTGTTGG + Intronic
1027345576 7:77256467-77256489 GAAGGAACTAGAAGAATTGTTGG + Exonic
1027713946 7:81645112-81645134 ATAGAAACAATAACAATTGTAGG - Intergenic
1027720207 7:81731466-81731488 TTAGGAAGAACAAAAATTATTGG + Intronic
1028178490 7:87686146-87686168 ATTGTAAGAAAAAAAATTGTGGG - Intronic
1028277774 7:88879025-88879047 AAAGGGAGAAGAAGAAATGTTGG + Intronic
1028416273 7:90583757-90583779 TTGGGAAGAAGAAGAATGGAAGG - Intronic
1028861187 7:95652482-95652504 ATACTTAGAAGTAGAATTGTGGG + Intergenic
1029013327 7:97286290-97286312 ATACCTAGAAGTAGAATTGTTGG + Intergenic
1030034439 7:105396667-105396689 AGAAGAGGAAGAAGAATAGTAGG + Intronic
1030198106 7:106873001-106873023 CCAGGAAGAAAAAGAATTATAGG - Intronic
1030251609 7:107451624-107451646 GTAGGAGGAAGAAGAAGTGTCGG - Intronic
1030815992 7:114038387-114038409 ATTGAAAGAAGAAGAGTTTTTGG - Intronic
1031281098 7:119800284-119800306 ATTGGAAGATGAAGAATTGTTGG + Intergenic
1031741050 7:125431044-125431066 ATATGAAGAGTAAGAATTATTGG + Intergenic
1033313363 7:140278597-140278619 CTAGGAACAACAAGGATTGTTGG - Intergenic
1033686317 7:143644348-143644370 AGAGAAAGAGGAAGAACTGTTGG - Intronic
1033689421 7:143722967-143722989 AGAGAAAGAGGAAGAACTGTTGG + Intronic
1033698296 7:143813273-143813295 AGAGAAAGAGGAAGAACTGTTGG + Intergenic
1033937097 7:146599592-146599614 ATAAGGAGGAGAAGAATTATGGG - Intronic
1034587228 7:152105061-152105083 GTAGGAAGAAAAAGAAATGAAGG - Intronic
1035722063 8:1799334-1799356 AGAAGAAGAACAAGAATTGGAGG - Intergenic
1035750697 8:1994145-1994167 ATTGGAAGAAGTAAAATTATTGG - Intronic
1035861575 8:3034184-3034206 ACAGGTAGAAGAAAAATAGTTGG + Intronic
1036040619 8:5076238-5076260 AAAGGAAAAAGAAGAATACTTGG + Intergenic
1036187052 8:6631817-6631839 ATACCCAGAAGAGGAATTGTTGG - Intronic
1036523264 8:9512064-9512086 GTAAGAAGAAGAAGAATGGTGGG - Intergenic
1037084653 8:14833704-14833726 ATAGGAAGAAGCAGCATAGTTGG + Intronic
1037939521 8:22941180-22941202 ATAGGAAAAAAAAGAATGGGTGG + Intronic
1038060352 8:23905449-23905471 AGAGGAAGAAGAGGAAATGTGGG - Intergenic
1038105140 8:24424377-24424399 ATAGGAAGGGGAAGAGTTCTTGG - Intergenic
1039370037 8:36974996-36975018 ATATGTAGCAAAAGAATTGTTGG + Intergenic
1039986510 8:42452332-42452354 ATAGGAGGAGGAAGAAATGGAGG + Intronic
1040587146 8:48755019-48755041 ATAAGAAGAAAAATAAATGTAGG - Intergenic
1041472836 8:58230391-58230413 CTATGAAGATGAACAATTGTAGG - Intergenic
1041668784 8:60471854-60471876 CTAGGAAGAAGAGGAAGAGTAGG + Intergenic
1041843543 8:62299690-62299712 ATAGGAAGCAGAAAAATTTGGGG - Intronic
1041902764 8:63000090-63000112 ATATCAAGAAGCAGAATTGCTGG - Intergenic
1041924565 8:63223074-63223096 TTAGGAAGCATAGGAATTGTGGG - Intergenic
1042219019 8:66455142-66455164 ATAGGTAGGAGCAGAATTGCTGG + Intronic
1042333515 8:67607150-67607172 AGAGGAAGAAGAAGAAGAGGAGG - Intronic
1042406901 8:68416145-68416167 CTAGGAAGAAGAACAATGTTAGG + Intronic
1042787320 8:72563269-72563291 ATAGGAAATAAAAGAATTTTAGG + Intronic
1043179611 8:77070717-77070739 ATAGCCAGAAGTAGAATTGCTGG + Intergenic
1043197088 8:77308932-77308954 ATAGGAAAAAGGTGACTTGTTGG + Intergenic
1043629984 8:82318706-82318728 AAAAGAAGAAGAAGAACTGATGG - Intergenic
1043712363 8:83438104-83438126 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
1043880604 8:85538431-85538453 AGAGAAAGAAAAAGATTTGTGGG - Intergenic
1044393156 8:91676900-91676922 GGAGGAAGAAAAAGAAGTGTTGG - Intergenic
1044394178 8:91690161-91690183 ATACCCAGAAGAAGGATTGTTGG - Intergenic
1044544450 8:93444105-93444127 AGATGAAGAAGAAGAAGTGCAGG + Intergenic
1044864128 8:96552933-96552955 ATTGAATGAAAAAGAATTGTAGG + Intronic
1044886723 8:96786538-96786560 ATACCAAGAAGTAGAATTGCTGG + Intronic
1045200093 8:99971764-99971786 ATAGGAAGAATCAGTATCGTGGG + Intronic
1045943866 8:107772169-107772191 ATAGGAAGGAGACCAATTTTTGG - Intergenic
1046306062 8:112368675-112368697 ATATGAAGATGAAAAATTATGGG + Intronic
1046366691 8:113241194-113241216 ATAACAAGAAGAAAAATTATGGG + Intronic
1046373412 8:113342973-113342995 AGAGGAAGAAGAAAAATGGAAGG + Intronic
1046557679 8:115795796-115795818 ATAGGAAGAAGGATAAGGGTTGG - Intronic
1046564097 8:115876492-115876514 CTTGGAAGAAGCAGAGTTGTTGG - Intergenic
1046726700 8:117682750-117682772 ATATGCAGAAGTAGAATTGCTGG - Intergenic
1047327061 8:123849920-123849942 ATATGAATGAGAAGAATGGTGGG + Intergenic
1047436561 8:124839794-124839816 AAAAGAAGAAGAAGAAGTGCTGG + Intergenic
1047622021 8:126617699-126617721 ATAGGAAAGAGAAGACTTGTGGG + Intergenic
1047780636 8:128108128-128108150 ATACCTAGAAGAGGAATTGTTGG + Intergenic
1047810721 8:128405882-128405904 ATATGAAGAATAAGAAATCTGGG + Intergenic
1048477510 8:134756670-134756692 TTAGGAGGAAGCAGAACTGTAGG - Intergenic
1048521463 8:135159318-135159340 ATGGGAAGAACATGAATTCTGGG - Intergenic
1049497806 8:142944799-142944821 AAAGGAAGAAGGAGAAAAGTGGG - Intergenic
1050354078 9:4766744-4766766 AAAAGAGGAAGAAGAATGGTGGG + Intergenic
1050430706 9:5558863-5558885 ATAGAAAGAAAAATAAATGTGGG + Intronic
1050456379 9:5838542-5838564 AGAAGAAGAAGAAGAATTCATGG + Intergenic
1051509839 9:17865442-17865464 CTAGGAAGCAAAAGAAATGTAGG + Intergenic
1052245956 9:26335303-26335325 ATATGAAGAAGAGGGATTTTTGG + Intergenic
1052397130 9:27952026-27952048 ATAGGAAGAGGTATAATTTTTGG + Intronic
1052455853 9:28697233-28697255 CTAGGAAGAAGAGGAAATGAGGG - Intergenic
1052498823 9:29262099-29262121 AAGGAAAGAAGAAGAACTGTTGG + Intergenic
1053022801 9:34707700-34707722 AGAAGAAGAAGAAGAAAGGTAGG - Intergenic
1053052581 9:34973990-34974012 AAAAGAAGAAGAAGATTTGTTGG - Intronic
1053378844 9:37632012-37632034 ATAAAAAGAAGAAAAATTGCTGG + Intronic
1054408026 9:64778892-64778914 AAAGGAAGAGGAAGAAAAGTAGG + Intergenic
1054744572 9:68841803-68841825 TTAGAAAGAAGAAGGATTGTAGG + Intronic
1055024967 9:71709793-71709815 AGAGAAAGCAGAAGAGTTGTGGG + Intronic
1055443404 9:76358693-76358715 ATAGGAGGAGTAAGACTTGTTGG - Exonic
1055526313 9:77137386-77137408 ATAAGAAGCAAAAAAATTGTAGG + Intergenic
1055813030 9:80173627-80173649 TTAGGAAGAAGAAAAAATTTGGG + Intergenic
1055864290 9:80794247-80794269 ATAGGAAGAAGAAGAAGACACGG + Intergenic
1055930590 9:81555942-81555964 ATAGGAAGAGGAAGAGTAGAAGG - Intergenic
1056188013 9:84155391-84155413 ACAGGAAGAAGAAGAAGTGATGG + Intergenic
1056247687 9:84712989-84713011 ACAGAAAGAAGCAGAATTGTTGG + Intronic
1056328030 9:85497205-85497227 AGAGGAAGAAGAAGAAGAGGAGG + Intergenic
1056433658 9:86554121-86554143 ATAAGAAGAAGAAGAAGAGGAGG - Intergenic
1056433668 9:86554193-86554215 AAAGGAAGAAGAAGAAGAGGAGG - Intergenic
1057084113 9:92192888-92192910 AGAGAAAGCAGAAGAATTATAGG + Intergenic
1057250685 9:93499087-93499109 ATAGGATGAAGAAGAATCAGAGG + Intronic
1057501221 9:95597915-95597937 ATTGGAATTAGAGGAATTGTTGG + Intergenic
1057894221 9:98894203-98894225 ATGGGAAAAAGCAGCATTGTCGG - Intergenic
1058059705 9:100482159-100482181 AAAAGAAGAAGAAGAAGAGTCGG - Intronic
1058089581 9:100789504-100789526 ATAGAAAGAAGAAGATATGTAGG + Intergenic
1058548375 9:106085910-106085932 ATGGAAAGAAAAAGAATTGGAGG + Intergenic
1059438914 9:114291844-114291866 ATAAGGAGGAGAGGAATTGTGGG + Intronic
1059592369 9:115675620-115675642 ATATGAAGAAGCAGATATGTAGG - Intergenic
1059800243 9:117742840-117742862 ATGGGCAGAATTAGAATTGTGGG + Intergenic
1060462329 9:123868771-123868793 TTAGGAAAAAGAAGAAATCTGGG + Intronic
1060491439 9:124088121-124088143 ACAGGAAAAAGAAGGATTCTAGG + Intergenic
1060501945 9:124164842-124164864 ATAGGGACAAGAAGAATTGTTGG - Intergenic
1060726249 9:126007792-126007814 ATAGCAACTAGAAGGATTGTAGG - Intergenic
1060732342 9:126046689-126046711 ATAGGAGGAAGAAGAAGAGGAGG - Intergenic
1060946436 9:127571855-127571877 ATGGGATGAAGGAGAATTGATGG + Intronic
1061464421 9:130766489-130766511 TTAGGAAGATGAGGAAGTGTAGG + Intronic
1061503984 9:131020273-131020295 AGAGGAAGAACAAGAACAGTGGG - Intronic
1203637225 Un_KI270750v1:124357-124379 GAAGGAAGAAGAAGAAATATTGG + Intergenic
1185489395 X:509502-509524 ATAAGAAGAAGAAGATATCTTGG - Intergenic
1185830200 X:3294328-3294350 AAAGGAAGAGGAAGAATAGGAGG - Intergenic
1186047289 X:5550303-5550325 AAAGGAAGAAGAAGAATAAGAGG - Intergenic
1186287731 X:8064115-8064137 ATGGAATGAACAAGAATTGTTGG - Intergenic
1186325555 X:8472843-8472865 AGAGGAACTAAAAGAATTGTTGG - Intergenic
1186579147 X:10798578-10798600 AGATGAAGAAGAAAAATTCTGGG + Intronic
1186584823 X:10861826-10861848 ATAGGAACTAGAAAAATTTTTGG + Intergenic
1186614357 X:11171085-11171107 GAAGGAGGAAGAAGAAATGTAGG + Intronic
1186694439 X:12015009-12015031 ATATAAAGAAGAAGAAGAGTGGG + Intergenic
1187360541 X:18622895-18622917 ATTGGAACAAGAAAATTTGTGGG + Intronic
1187398072 X:18935170-18935192 ATGGTTAGAAGAAGAATTCTTGG - Intronic
1187568241 X:20474416-20474438 ATAAGAAAAAGAAGAAATGGAGG - Intergenic
1188042566 X:25386754-25386776 ATAGGAAGAAGGAGAGATATAGG + Intergenic
1188650234 X:32623293-32623315 AGAGGAAGAAGCAAAATTGAAGG + Intronic
1188865892 X:35312710-35312732 CTTAGAAGAAAAAGAATTGTAGG + Intergenic
1188875087 X:35419630-35419652 ATACGCAGAAGTAGAATTGTCGG + Intergenic
1188979108 X:36710690-36710712 ATATCAAGAAGTAGGATTGTTGG - Intergenic
1189748714 X:44196518-44196540 ATAGTGAGAAGAAGAACTGAAGG + Intronic
1191627226 X:63282415-63282437 AGAGGAAGCAGATGAATTGTAGG + Intergenic
1192187020 X:68954075-68954097 AAATGAAGCAGAATAATTGTTGG - Intergenic
1193079586 X:77392511-77392533 ATGGGAAGAAGAAAAACTGAGGG + Intergenic
1193110364 X:77723307-77723329 ATATCTAGAAGTAGAATTGTTGG - Intronic
1193196836 X:78642340-78642362 ATAGCAATAAAAAGTATTGTAGG - Intergenic
1193669847 X:84370920-84370942 ATATGAAATAGAAGAATTGTTGG + Intronic
1194012568 X:88581187-88581209 TTAGAAATCAGAAGAATTGTGGG - Intergenic
1194804831 X:98314434-98314456 ATAGGAAGAAAAAAAATGGTGGG + Intergenic
1194820766 X:98504304-98504326 ATAGGAAGAAATGGAATTATAGG + Intergenic
1194910882 X:99643179-99643201 ATAGGATGAAGAAAACTTGGAGG + Intergenic
1194955686 X:100177290-100177312 ATATGAAGAGGAAGAATTTTGGG + Intergenic
1195429687 X:104774682-104774704 ATAGGAAGCAGAAGAGTGGTGGG + Intronic
1195500914 X:105597937-105597959 ATACCCAGAAGAGGAATTGTTGG - Intronic
1196190378 X:112788419-112788441 AAAGGAATAAAAAGAAATGTTGG + Intronic
1196327525 X:114425279-114425301 TTAGGAAAAAAAAAAATTGTGGG + Intergenic
1196352612 X:114749552-114749574 ATAGGATGAAAGAGAATTGTAGG + Intronic
1196730993 X:118941355-118941377 GGAGGAAGAAGAAGAATAGGAGG + Intergenic
1196744001 X:119052084-119052106 AGAAGAAGAAGAAGAATTGCAGG - Intergenic
1196816675 X:119670579-119670601 AGAAGAAGAAGAAGAATTGCAGG + Intronic
1197033678 X:121849263-121849285 AGAGGAAGAAGAAGAAGAGCAGG - Intergenic
1197081307 X:122420830-122420852 ATAGTAGGAAGATGGATTGTGGG - Intergenic
1198230950 X:134688935-134688957 AAAGGAAGAAGAAATAATGTGGG - Intronic
1198323092 X:135539158-135539180 ATAGGAAGAAGATGCAATCTAGG - Intronic
1198894390 X:141436330-141436352 TTAGGATAAAGCAGAATTGTAGG - Intergenic
1199167735 X:144697258-144697280 GTAGGAAGAAGAAGAGTGGGAGG - Intergenic
1199903089 X:152196844-152196866 TTTGGAAGAAGTAGCATTGTAGG - Intronic
1199923595 X:152437399-152437421 ATAGGAAGACTCAGTATTGTTGG + Intronic
1200881490 Y:8217460-8217482 AAAAAAAGAAGAAGAATTTTGGG - Intergenic
1200923475 Y:8633538-8633560 AGAGGAAGAAGAAGAAGAGGAGG - Intergenic
1202360784 Y:24107908-24107930 CTAGGAAGAATAAGCTTTGTGGG + Intergenic
1202509994 Y:25562210-25562232 CTAGGAAGAATAAGCTTTGTGGG - Intergenic