ID: 1091249337

View in Genome Browser
Species Human (GRCh38)
Location 11:134129086-134129108
Sequence ACCAGGGATGTGCCTGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 5, 3: 23, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091249337 Original CRISPR ACCAGGGATGTGCCTGCACA GGG (reversed) Intronic
900435374 1:2628569-2628591 ACCAGGGCTGTGCCTGCGGAGGG + Intronic
900702996 1:4059446-4059468 ACCAGGGCTGTCCATGCTCAGGG + Intergenic
900777311 1:4594689-4594711 GCCAGGGCTCTGTCTGCACAGGG - Intergenic
901079345 1:6575043-6575065 CCCAGTGATGTGCCTGGAGAGGG - Exonic
905915536 1:41681923-41681945 AGGAGGGATGTGCCTGAGCAGGG - Intronic
907413942 1:54301462-54301484 AACAGGGATGTGGCTGGGCATGG - Intronic
907957523 1:59244358-59244380 ACCAGGGATGTCCATACATAGGG - Intergenic
916126443 1:161575637-161575659 CCCAGAGATGAGCCTGCCCAGGG + Intergenic
916136362 1:161657477-161657499 CCCAGAGATGAGCCTGCCCAGGG + Intronic
916245898 1:162687788-162687810 ACCAGGTATGTAACTGCACTAGG - Intronic
917638541 1:176959907-176959929 TGCAGGGAGGTGCCTGCACCAGG + Intronic
917837970 1:178955943-178955965 ACCTGGCATGTGCCCTCACAGGG + Intergenic
920890839 1:209984330-209984352 ACGAGGGATGTGCTTGCTGAAGG - Intronic
921830690 1:219724679-219724701 GCCAGGGATGTGTCTGCAGGGGG - Intronic
923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG + Intronic
1062860032 10:803712-803734 AGCAGGGCTGAGCCTGCAGAGGG - Intergenic
1066057499 10:31695606-31695628 ATCAGGGATGCGCTTGCACAGGG - Intergenic
1066457835 10:35587041-35587063 ACCAGGGAGGTGCGTGCACAGGG - Intergenic
1067093703 10:43284940-43284962 ACCAGGGAAGTGCCTGGCAATGG + Intergenic
1069352353 10:67544109-67544131 ACTAGGAATGTGGCTGCATATGG + Intronic
1071394151 10:85205203-85205225 ACCAGGGATCTGGCTGCATGTGG + Intergenic
1072682604 10:97517660-97517682 CCCTGGGATGTGACTGGACATGG + Intronic
1072741506 10:97912679-97912701 CCCAGGGATGAGGCAGCACAAGG + Intronic
1073452209 10:103616696-103616718 ACCAGGGACGTGGCTGCAAGAGG + Intronic
1076266813 10:129115109-129115131 ACCAGAAATGTGCCTGAAAAAGG + Intergenic
1077985955 11:7351311-7351333 ACCAGGGATGTGGCTAGCCAGGG + Intronic
1079098430 11:17526222-17526244 ACCAGGGGTGTGACTGTCCATGG - Intronic
1080156432 11:29117165-29117187 ACCAGTTATGTGACTGGACAAGG - Intergenic
1081015431 11:37872239-37872261 AGCAGGATGGTGCCTGCACATGG + Intergenic
1081813716 11:45927332-45927354 GCCAGGCCAGTGCCTGCACAGGG - Exonic
1082215594 11:49563882-49563904 AGCAGGGATGAGTCTGCACCAGG - Intergenic
1084156443 11:67315707-67315729 ACCGGGGAGGAACCTGCACATGG - Intergenic
1084308236 11:68300366-68300388 AACAGGGATGGCCCTGCCCAGGG - Intergenic
1084699722 11:70778578-70778600 AGCAGAGGTGTGCATGCACAAGG + Intronic
1085440702 11:76559964-76559986 ACGAGGGAAGAGCCGGCACAAGG - Intergenic
1085450719 11:76630464-76630486 AACAGGAACGTGCCTGCAGAGGG - Intergenic
1087554317 11:99695403-99695425 ACCAGGGTGTTGCCTGCAAAAGG + Intronic
1088722773 11:112609042-112609064 ACCATGGAGATGCCTGCAAAGGG + Intergenic
1091139691 11:133224315-133224337 CCCAGGGATGCCCCTGCAGATGG + Intronic
1091160423 11:133414769-133414791 ACCAGGGAAGTGCTTTCAAATGG - Intronic
1091249337 11:134129086-134129108 ACCAGGGATGTGCCTGCACAGGG - Intronic
1092060846 12:5549047-5549069 ACCAGGGAAGGGCATGCCCAGGG + Intronic
1092656981 12:10696195-10696217 ACCAGAGACATGCGTGCACAGGG - Intergenic
1093561596 12:20548309-20548331 ACCAAGGTTATGCCTGCAAATGG - Intronic
1093765025 12:22952862-22952884 GCCAGGTGTGTGCATGCACAGGG - Intergenic
1094639737 12:32262350-32262372 ACCAGGGATGGGGCTGGAGAAGG - Intronic
1096551179 12:52372797-52372819 GCCAGGGATCTGCCTGCAGCTGG + Intergenic
1100587751 12:95995523-95995545 GCGTGGCATGTGCCTGCACAGGG + Intronic
1100980774 12:100160723-100160745 ACCAAGGCTGTCCCTGCACCTGG + Intergenic
1102485169 12:113250574-113250596 CCCAGGGTTGTCCCTGCCCAAGG - Intronic
1103998409 12:124844641-124844663 ACCGGGGATGTGCGCACACAGGG + Intronic
1105453146 13:20518182-20518204 AACTGGGCAGTGCCTGCACATGG - Intronic
1105702776 13:22945541-22945563 ACCAGGCATGTTCCTCCACCTGG - Intergenic
1105855415 13:24367345-24367367 ACCAGGCATGTTCCTCCACCTGG - Intergenic
1118589803 14:67392837-67392859 ACCAGGGAGGAGCCTGGCCAAGG + Exonic
1118597865 14:67449919-67449941 TACAGGTATGTGCCTCCACAAGG - Intronic
1120703270 14:87722093-87722115 ACCAGGAAGGTGCTTGCACAGGG - Intergenic
1120730502 14:87995636-87995658 ACCATGTATGTGCCTGAAAAGGG + Intergenic
1121458088 14:94051946-94051968 ACCAGTGCTGTGACTGCACATGG + Intronic
1121814208 14:96916559-96916581 ACCAGGAGTGTGCATGAACAGGG + Intronic
1122071718 14:99209422-99209444 ACCAGGCTTGTTCCTTCACATGG - Intronic
1122844410 14:104483786-104483808 ACCAGGCATGTCCCTCCACCTGG - Intronic
1123896529 15:24836151-24836173 ACCAGGGATGTGCAAGCACAGGG - Intronic
1124416329 15:29475616-29475638 TCCAGGGATGTGTCTGCCCTTGG - Intronic
1124579366 15:30939372-30939394 AGCAGTGGTGTGGCTGCACAGGG - Exonic
1125383900 15:39115696-39115718 CCTAGAGATGTGCCTACACATGG - Intergenic
1129832953 15:78682455-78682477 CCCAGGGAGGTGCCTGCAGGAGG + Intronic
1130383622 15:83392856-83392878 ACCAAGGATCTACTTGCACATGG - Intergenic
1131375703 15:91921209-91921231 ACCAGGGATGTGTATGCAGAGGG - Intronic
1131963415 15:97812064-97812086 AACAGGGTTGGGCCTGCACAAGG - Intergenic
1132125840 15:99223407-99223429 ACCAGGGATGGGCATGCATATGG + Intronic
1132710822 16:1266361-1266383 CCCAGTGCTGTGTCTGCACAGGG + Intergenic
1133232967 16:4374965-4374987 ACCAGGGCTGGGCCCTCACACGG - Intronic
1134243525 16:12523202-12523224 GCCAGCTCTGTGCCTGCACAGGG + Intronic
1134434716 16:14245867-14245889 AACTGGTAGGTGCCTGCACAAGG - Intronic
1134451762 16:14368179-14368201 CCCAGAGATGGGCCTGCCCAGGG + Intergenic
1134844760 16:17430539-17430561 TCCAGGAATGGGCCTGCACTTGG - Intronic
1138183495 16:54959280-54959302 ATCAGAAATGTGCCTGCCCATGG - Intergenic
1138392167 16:56677691-56677713 CCCAGGGATGTGTTTGCAAAGGG + Exonic
1142980103 17:3666711-3666733 ACCAGGAACGTGCCTGGACATGG - Intronic
1144663257 17:17085200-17085222 GCCCGGGAGGTGCCTACACAGGG - Intronic
1148092435 17:45030680-45030702 AGCAGGGCTGGGCCTGCACCTGG - Intronic
1148756076 17:49973601-49973623 CCCAGGACTGTGCCTGCACCTGG + Intronic
1149548964 17:57525710-57525732 ACCAGGGTTCTGCCAGGACATGG + Intronic
1152151140 17:78602156-78602178 AGCAGGAATGTGCCTGCCTAGGG + Intergenic
1152751002 17:82062367-82062389 CCCGGGGATGAGCTTGCACAGGG - Intronic
1152869454 17:82744181-82744203 ACCAAGAATCTCCCTGCACATGG - Intronic
1156196234 18:34776896-34776918 ACCAGGCATGTGCCCGCATAGGG + Intronic
1157733676 18:50027347-50027369 AGGAGGGTTCTGCCTGCACAGGG + Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160835160 19:1121558-1121580 ACCAGGGCTGAGCCTGGCCAAGG + Intronic
1160866792 19:1259750-1259772 ACCAGGGGTGTTCCTAGACAGGG - Intronic
1160895236 19:1399361-1399383 ACCGGGGATGGGCATGCTCACGG - Intronic
1161530358 19:4785331-4785353 GCCCGAGATGTGCCTGCGCATGG + Intergenic
1161700388 19:5791272-5791294 ACGGGGGCGGTGCCTGCACATGG + Intergenic
1162664357 19:12197005-12197027 TACAGGCATGTGCCTCCACACGG + Intergenic
1164464044 19:28472438-28472460 ACCAGAGAAGTGCCATCACAGGG + Intergenic
1165012355 19:32858234-32858256 GGCATGGATGGGCCTGCACACGG - Intronic
1165019221 19:32909360-32909382 GCCAGGGAGATGCCTGCACAGGG + Intronic
1167094652 19:47368178-47368200 AGCAGGCATGTGCCCCCACAGGG - Intronic
1167182040 19:47912078-47912100 AGCAGGCATGTGCCCCCACAGGG + Intergenic
1167184006 19:47927846-47927868 AGCAGGCATGTGCCCCCACAGGG + Intergenic
1167185329 19:47938559-47938581 AGCAGGCATGTGCCCCCACAGGG + Intergenic
1167186647 19:47949316-47949338 AGCAGGCATGTGCCCCCACAGGG + Intergenic
1167187298 19:47954704-47954726 AGCAGGCATGTGCCCCCACAGGG + Intergenic
1167212108 19:48139747-48139769 ACCAGGCATGTGCTGGGACAGGG - Intronic
1167541891 19:50093560-50093582 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167543871 19:50108095-50108117 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167544545 19:50113449-50113471 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167545220 19:50118799-50118821 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167545897 19:50124151-50124173 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167546574 19:50129486-50129508 AGCAGGCATGTGCCCCCACAGGG - Intergenic
1167547234 19:50134820-50134842 AGCAGGCATGTGCCCCCACAGGG - Intergenic
925189991 2:1874950-1874972 ACCACGGATGGGCCAGCAGACGG - Intronic
925586334 2:5468223-5468245 ACCAGGGATTTGACTGCAGCAGG + Intergenic
929234486 2:39591724-39591746 GACAGGGATGGGACTGCACAGGG + Intergenic
932165927 2:69507016-69507038 TCCATGAATGTGCCTTCACATGG - Intronic
932491729 2:72127092-72127114 ACCAGGGCTGAGCGGGCACAGGG + Intergenic
935736765 2:106112316-106112338 GCCAGGGGTGTGCCTGTACTGGG - Intronic
936345244 2:111670785-111670807 ACCAGGCATGGGCCTGGGCATGG + Intergenic
937310627 2:120900711-120900733 ACAAGGGATGTGCGTGGAGACGG + Intronic
938255358 2:129855168-129855190 ACCAGGGATGTGTGCACACAAGG - Intergenic
941086512 2:161124378-161124400 ACAAGGGACCTGCCTGTACAGGG + Intergenic
943847621 2:192672497-192672519 ACCAAGCAAGTGCCAGCACAAGG - Intergenic
943848847 2:192689581-192689603 CACAGGGATGTGCATGCAGAGGG - Intergenic
1170767711 20:19305069-19305091 CCCAGGGATGTGACAGCCCATGG - Intronic
1172473392 20:35218142-35218164 CCCAGGGCTGTGTCTGCAAAGGG + Intergenic
1174819359 20:53713602-53713624 ACCAGGGCTGTGGGTGGACAAGG + Intergenic
1175047692 20:56122743-56122765 ACTAGAGATGTGCCCTCACATGG + Intergenic
1175822384 20:61917358-61917380 ACCTGGGATGAGCCTGGACCTGG - Intronic
1177078560 21:16609569-16609591 ACCAGGGATGGGCCGACAGAAGG + Intergenic
1178678059 21:34647612-34647634 CCCAGGAATGTGGCTGCACAAGG + Intergenic
1179682488 21:43033378-43033400 GCCAGGAATGGGCCTTCACAAGG - Exonic
1179966654 21:44810704-44810726 GCCAGGGCTGTGCATCCACATGG - Intronic
1182427535 22:30282847-30282869 CCCAGGGAGGGGCCTGCCCACGG - Intergenic
1183206490 22:36423016-36423038 CCCAGGGGTGGGCCTGCACATGG + Intergenic
1183384060 22:37504841-37504863 ACCTGCCATGTGCCAGCACAGGG + Intronic
1183686470 22:39363827-39363849 CTCAGGGATGTTCCTGCGCAGGG + Intronic
1184278943 22:43426367-43426389 AGCAGGGAGGTGACAGCACAGGG + Intronic
1184418371 22:44364893-44364915 TCCAGGGCTGGGCCTGCCCAGGG - Intergenic
949231739 3:1757712-1757734 ACCAGAAGTGTGCCTACACATGG - Intergenic
950662459 3:14474983-14475005 AACAGGCATCTGCCTCCACATGG - Intronic
952564133 3:34634885-34634907 ACCAGAAATGTGTGTGCACAGGG + Intergenic
952809499 3:37388595-37388617 ACCAGGCATCTGTCTCCACATGG - Intronic
953361366 3:42300254-42300276 TTCTGGGATGTGCCTGCACCTGG - Intergenic
954257439 3:49416502-49416524 AACAAGGGTGTGCATGCACAGGG + Intergenic
954795143 3:53157551-53157573 AGCAGGGAAGTGCCAGCCCAGGG - Intronic
954900678 3:54016575-54016597 ACAGGGGATGTGCATGCCCATGG - Intergenic
956057660 3:65317705-65317727 ACCAGAGATGTGACTGGAAAAGG - Intergenic
956794917 3:72709156-72709178 ACCAGGGAAGCACCTGCACTGGG + Intergenic
961060720 3:123826015-123826037 GCCAGGGACATGCCTGCAAAGGG - Intronic
962239868 3:133743359-133743381 CCCAGGGCTTTGCCAGCACAGGG - Intergenic
963836774 3:150066022-150066044 ACCAAGGATGGCACTGCACAAGG - Intergenic
964302065 3:155299777-155299799 ACAAGGGATGAGCCAGAACAAGG + Intergenic
965229269 3:166029526-166029548 ACCCAGGATGTTCCTGCCCAGGG + Intergenic
965473201 3:169120972-169120994 ACCAGGAGAGTGGCTGCACATGG - Intronic
966220207 3:177544204-177544226 ACCAGGGTGGTGCCTGCACCAGG - Intergenic
967256756 3:187601072-187601094 GCATGGGATGTGCCTGCCCAGGG - Intergenic
968132324 3:196198821-196198843 ACCAGGGCTGTGCCAGCAACTGG - Exonic
968503499 4:961623-961645 ACGAGGGCTGAGCCTGCCCATGG + Intronic
969886064 4:10216634-10216656 ATAAGGGATGTGCCTGTAGAAGG - Intergenic
970247003 4:14074032-14074054 TAGAGGGCTGTGCCTGCACATGG + Intergenic
971384553 4:26131287-26131309 TGCAGGGATGTGACTGCATAGGG - Intergenic
972655726 4:41062007-41062029 ACCAGGCCTGTGTCTGAACAGGG - Intronic
980902762 4:138920705-138920727 GCCAGGCATGTGACTGAACATGG + Intergenic
984814365 4:183822937-183822959 TCCACGGCTGAGCCTGCACATGG + Intergenic
985107104 4:186510195-186510217 AGCAGGGATGTTCCTTCTCATGG - Intronic
998963901 5:147517109-147517131 TCCAGGGAGCTGCCTGGACAGGG - Intergenic
999394308 5:151217297-151217319 AACAAGGAGGTGCCTGGACAGGG - Intronic
999946057 5:156597048-156597070 ACCAGGGATTAGACTGCACCTGG - Intronic
1000662799 5:163956667-163956689 ACCAGGGATGTGCATGCACAGGG + Intergenic
1001678539 5:173538359-173538381 ACCAGGGATGTGCACCCAAAGGG - Intergenic
1002427289 5:179183791-179183813 ACCAGGCCTCTGCCTGCAAATGG + Intronic
1003217235 6:4125503-4125525 ACCAGGGAAGTGGCAGGACAAGG - Intronic
1003271629 6:4612972-4612994 ACAAGGGCTGTGCCTGCACTTGG + Intergenic
1004120188 6:12814045-12814067 AGGAGGGATGTGTCTTCACAGGG - Intronic
1006337637 6:33428658-33428680 GCCAGGGATATGCATGCTCAGGG - Intronic
1006449854 6:34099593-34099615 ATCAGGGATGGGCCTGGTCAGGG - Intronic
1008906475 6:56682705-56682727 ACCAGACATATGCCTGCTCATGG + Intronic
1012777576 6:103517125-103517147 ACCAGGGATGCATGTGCACAAGG + Intergenic
1013534727 6:111053484-111053506 ACTAGGGATGTGCAGGCACAGGG - Intergenic
1017946983 6:159103975-159103997 GACAGGGCTGTGCCTGCAAATGG + Intergenic
1019001874 6:168760756-168760778 ACCAGGGATGTTCCAGCCCCTGG + Intergenic
1021957947 7:25845185-25845207 CCCATGGATGGGCCTGGACAAGG - Intergenic
1022451887 7:30523469-30523491 ACCAGAGATGAGAATGCACATGG + Intronic
1023996283 7:45161006-45161028 ACCAGCCCTGGGCCTGCACAAGG - Intronic
1030045743 7:105493710-105493732 ACCAGGGGTGTGCGTGCACAGGG + Intronic
1032833464 7:135652027-135652049 TCCAGGCATGTGCCTGGGCAGGG - Intergenic
1035217367 7:157378205-157378227 ACCAGTGAGGTGCCTGCTGAAGG - Intronic
1035294832 7:157861149-157861171 TCCAGGGATGTGCCAGCTCAGGG + Intronic
1035369593 7:158371111-158371133 ACCAGGTATGTGACTGCGCAGGG + Intronic
1035613512 8:985453-985475 ACTACGGATGTGCTGGCACATGG - Intergenic
1035672417 8:1429673-1429695 AGCAGGGATGAGCCTGCAGCAGG + Intergenic
1037846972 8:22292099-22292121 ACCCTGCATGTGCCTGCACCAGG - Intronic
1039209681 8:35199204-35199226 ACAAGGGATGTGCCTGCAAATGG + Intergenic
1041082207 8:54224634-54224656 ACCAGGCAGGTACCTGCACTGGG + Intergenic
1041340696 8:56842868-56842890 ACCTGGGCTGTGTCTGCACGTGG - Intergenic
1041856453 8:62461014-62461036 TCCAGGGCTGTGCCTGCTCAGGG + Intronic
1042918803 8:73901506-73901528 ACCAGGGTGATGCCTGCAAATGG + Intergenic
1044364430 8:91326443-91326465 ACAGGGGCTGTGCATGCACAGGG - Intronic
1044437110 8:92177323-92177345 ACCAGGGCAGAGTCTGCACACGG + Intergenic
1044538974 8:93389306-93389328 CACAGGGATGTGGCCGCACAGGG + Intergenic
1045046438 8:98283621-98283643 ACCTGGGCTGGGCCTGCAAAAGG - Intronic
1045980794 8:108184961-108184983 ACCAGGGATGTGTGTGCACAGGG + Intergenic
1046412106 8:113859197-113859219 CCCAGGGTCTTGCCTGCACATGG + Intergenic
1048117765 8:131544592-131544614 ACCAGGGATGCACACGCACATGG + Intergenic
1049642982 8:143723716-143723738 CCCAGGAGTGTGCCTGCACAGGG + Intergenic
1051586918 9:18736381-18736403 GCCTGGGATGTGCCTTCCCAAGG - Intronic
1053653321 9:40191397-40191419 ACCAGGCATAAGCATGCACACGG + Intergenic
1053903723 9:42820687-42820709 ACCAGGCATAAGCATGCACACGG + Intergenic
1054531264 9:66184821-66184843 ACCAGGCATAAGCATGCACACGG - Intergenic
1057250626 9:93498416-93498438 ACTGGGGATGTTCCTGCCCAGGG - Intronic
1058570080 9:106332170-106332192 ACCAGGGATATCCTTGCACAGGG - Intergenic
1061549222 9:131323610-131323632 ACCAGGGATGCACAAGCACAGGG + Intergenic
1061658165 9:132108871-132108893 GCCAGGACTGTGCCTGCACGTGG + Intergenic
1061767944 9:132894128-132894150 TCCATGGACGTGTCTGCACAGGG - Exonic
1062115804 9:134807659-134807681 TCCAGGGAAGTTCCTGCCCAGGG - Intronic
1062214064 9:135379535-135379557 ATCTGGGATGTACATGCACAGGG + Intergenic
1062573351 9:137195469-137195491 ACCCAGGATCTGCCTGCACAGGG + Intronic
1062615297 9:137393458-137393480 GCCAGGGTTGTGCCTGCTGAGGG + Intronic
1188722627 X:33542411-33542433 AGCAGTGATGAGCCTCCACAAGG + Intergenic
1190277672 X:48909785-48909807 ACCAGGGATGGGGCTGCACTGGG - Intronic
1190559175 X:51670545-51670567 ACCAGTGATGTTCCTCCAGAAGG + Intergenic
1190565116 X:51722776-51722798 ACCAGTGATGTTCCTCCAGAAGG - Intergenic
1196904604 X:120419129-120419151 ACAAGGGAAGTTTCTGCACATGG - Intergenic
1198314167 X:135450159-135450181 ATCATGCATGTGCCTGCAGATGG + Intergenic
1199742656 X:150750290-150750312 ACCTGGGATGTGGCTGCAGCGGG + Intronic