ID: 1091250715

View in Genome Browser
Species Human (GRCh38)
Location 11:134141680-134141702
Sequence GCTGGTGGGGGGCCCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091250705_1091250715 0 Left 1091250705 11:134141657-134141679 CCTTCTGCAGAGTCCGGGAGAGG 0: 1
1: 0
2: 2
3: 24
4: 242
Right 1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG 0: 1
1: 0
2: 1
3: 29
4: 277
1091250701_1091250715 13 Left 1091250701 11:134141644-134141666 CCCAAGTCAGAGGCCTTCTGCAG 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG 0: 1
1: 0
2: 1
3: 29
4: 277
1091250702_1091250715 12 Left 1091250702 11:134141645-134141667 CCAAGTCAGAGGCCTTCTGCAGA 0: 1
1: 1
2: 1
3: 27
4: 264
Right 1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG 0: 1
1: 0
2: 1
3: 29
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091250715 Original CRISPR GCTGGTGGGGGGCCCCAAGC TGG Intronic
900123267 1:1058630-1058652 GCTCCTGGAGGGCTCCAAGCAGG + Intergenic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900185632 1:1331935-1331957 GATGGTGGGGGGCGCCCACCTGG - Exonic
900339176 1:2179748-2179770 GCTGGTGGGAGGCCCCAGGGAGG + Intronic
900398875 1:2464736-2464758 GCTGGACAGAGGCCCCAAGCAGG - Intronic
900992627 1:6104882-6104904 GGTGCTGGGAGGCTCCAAGCGGG + Exonic
902754524 1:18540317-18540339 CCTGGCAGGAGGCCCCAAGCTGG + Intergenic
902843753 1:19093188-19093210 GCGGTTGGGAGGCCCCAAGGAGG + Intronic
902955691 1:19923033-19923055 GCTGGTGGGGAGCCCCTGGAAGG - Intronic
903647763 1:24905139-24905161 GGTGGTGGGGTGTCCCAAGGGGG + Intronic
905010616 1:34744660-34744682 GCAGGTGCGGGGTCCCAAGGAGG + Intronic
905274887 1:36810914-36810936 GCTTGTGGGGGGCTACAGGCTGG + Intronic
906612640 1:47213938-47213960 GCCCGTGGGGGGCACCAAGGAGG + Intergenic
907517886 1:55004858-55004880 GCTGGTGCTGTGCCCCAAGTAGG + Intronic
912446131 1:109738248-109738270 GCTGGTGAGGGACCCCAGGCTGG - Intronic
914044122 1:144077256-144077278 GCGGGTGGGGGGCAAAAAGCCGG - Intergenic
914961511 1:152213628-152213650 GCTGGAGGAGTGCCCCAAACCGG + Exonic
914962007 1:152216448-152216470 GCTGGAGGAGTGCCCCAAACCGG + Exonic
914962256 1:152217858-152217880 GCTGGAGGAGTGCCCCAAACCGG + Exonic
915342714 1:155185176-155185198 GCTGGTGGCAGGCCCCAATCAGG + Intronic
915462312 1:156077407-156077429 GCTGGTGGTGGGCCCCAAAGGGG - Exonic
919784731 1:201251994-201252016 GCTGATGGGGGGCTCCAAGGTGG + Intergenic
920189785 1:204186247-204186269 TCTAGTTGGGGGCTCCAAGCTGG + Intergenic
922753178 1:228080484-228080506 GGTGGTGGGGAGCCCAAACCAGG + Intergenic
922903549 1:229156892-229156914 GCTGGTGGGAGGCCGGAAGGAGG - Intergenic
923337961 1:232986254-232986276 GCTGGTGGAGGAGCCCAGGCTGG + Exonic
924199691 1:241646095-241646117 GCTTGGGAGGGTCCCCAAGCAGG - Intronic
924567906 1:245213242-245213264 GCTGGTGGGGGGCCTGGAGAGGG + Intronic
1064109985 10:12530261-12530283 GCGAGTGGGGGGCCCTAGGCAGG + Intronic
1067274417 10:44821443-44821465 GCTGGTTGGTGGCACCCAGCAGG - Intergenic
1068707695 10:60095000-60095022 GCTGGAGAGAGGCCCCAAGGGGG + Intronic
1068910571 10:62374574-62374596 GCTGGTGGGGGCCGGGAAGCCGG - Intronic
1069824288 10:71245787-71245809 TCAGGTGGGGTGCCACAAGCTGG + Intronic
1071527341 10:86366264-86366286 GCTGGGCGGGGGCCCCAACGGGG - Intronic
1072215444 10:93283736-93283758 GCTGGTGGGAAGACCCGAGCAGG + Intergenic
1072926449 10:99620828-99620850 GCTAGTGAGGGGCCCGAAGTCGG - Intergenic
1074014694 10:109522243-109522265 TCTGGTGAGGGTCCCCATGCTGG + Intergenic
1074130380 10:110568148-110568170 GCTGGCGGGGGGCACCCCGCCGG + Intronic
1074884309 10:117682922-117682944 TCTGGGGGTGGGCCCCAGGCAGG - Intergenic
1076757276 10:132579159-132579181 GCCGGTTGCGGGCTCCAAGCTGG + Intronic
1076797572 10:132805673-132805695 GCTGGGGGGCAGCCCCCAGCCGG + Intergenic
1076829023 10:132985097-132985119 GCTGGTGGGTTGCCCCAGGCGGG + Intergenic
1076991589 11:278803-278825 CCTGGTGCAAGGCCCCAAGCTGG + Intronic
1077222046 11:1422139-1422161 GCTCATGGGGGGCCCACAGCTGG - Intronic
1077295747 11:1825513-1825535 GCAGGTGGGGGGCCCCAGTCAGG + Intergenic
1077872004 11:6270476-6270498 ACTGGGGAGGGGCCCCAAACTGG - Intronic
1078467893 11:11563650-11563672 GCTGGTGGGGGCCCCACAGCCGG + Intronic
1080738060 11:35036875-35036897 GCTGGAGGAGGAACCCAAGCAGG - Intergenic
1081656222 11:44859144-44859166 GCTGGTCTGGGGGCCCACGCAGG + Intronic
1081716110 11:45251762-45251784 GCTGTTGGGGGGCCACAAGTGGG - Intronic
1081772914 11:45660772-45660794 GTGTGTGGGGGGCCCCAAGCTGG - Intronic
1081866573 11:46363602-46363624 GCAGGTCTGGGGCCGCAAGCTGG + Intronic
1083259781 11:61516650-61516672 GCTGGGGAGCGGCCCCCAGCCGG - Intronic
1084275215 11:68047824-68047846 GGTGCTGCGGGGCCCCCAGCCGG - Intronic
1084302091 11:68258603-68258625 GTTGGTGGTGGGCCCAAGGCCGG + Intergenic
1084362383 11:68677466-68677488 GCAGCTGGGGGGCCACAAGGAGG - Intergenic
1085297529 11:75439482-75439504 GCTGGGTGGGGGCCCCAGGCTGG + Intronic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1089688701 11:120172799-120172821 ACTGGGGAGGGGCCCCACGCAGG - Intronic
1090948385 11:131451498-131451520 GCTGGAAGGGGGTCCCATGCAGG + Intronic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1092140166 12:6178326-6178348 GATGGTGGGAGGCCACTAGCAGG - Intergenic
1092238647 12:6824559-6824581 GGTGGTGGGGGGACCAAAGCGGG + Exonic
1095891167 12:47235966-47235988 GCTGGGGTGGGAACCCAAGCAGG - Exonic
1098208827 12:68140837-68140859 GCTAGTGGGTGTCCCCAAGCAGG + Intergenic
1100433219 12:94548738-94548760 GCTGGTGGGCAGCCCCCAGGAGG + Intergenic
1101905316 12:108820423-108820445 GATGGTGGGAGGGCCCAGGCAGG - Intronic
1103938752 12:124490504-124490526 GCTGGTGGGAGCTCCCATGCTGG - Intronic
1104013548 12:124948234-124948256 GCTGCTGGGGGCCCGAAAGCAGG + Intronic
1104498839 12:129265660-129265682 GGTGTTGAGGAGCCCCAAGCAGG - Intronic
1104739972 12:131165029-131165051 GCTGGTGGGAGACGCCAGGCTGG + Intergenic
1104792507 12:131492936-131492958 GCTGGTGGGAGACGCCAGGCTGG - Intergenic
1105249111 13:18680596-18680618 GCAGGTGGGGGCCCCCGAGGAGG + Intergenic
1105821985 13:24087955-24087977 GCTGGAGGAAGGCCCAAAGCTGG - Intronic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1106478066 13:30114926-30114948 GCAGGTCGCGGGGCCCAAGCTGG + Intergenic
1106683421 13:32031465-32031487 GCTGGTGGGCGGCCGGCAGCCGG + Exonic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1112216465 13:97434878-97434900 TCTGGGGGGTGGCTCCAAGCTGG + Intronic
1113372743 13:109737842-109737864 GGAGGTGGGGTGCCCCAAGCAGG - Intergenic
1113922194 13:113919434-113919456 GCAGGTGTCGGGCCCCAGGCTGG + Intergenic
1113961856 13:114130730-114130752 GGGGGTGGGGGGCCCACAGCCGG - Intronic
1115405613 14:33012101-33012123 GCTGGAGGGAGGACACAAGCTGG - Intronic
1118735828 14:68701310-68701332 GGTGGTGCGGGGCCCAAAGACGG - Intronic
1119259330 14:73228228-73228250 GCTGGAGGTGGGCCCCATCCAGG - Intergenic
1119890627 14:78179515-78179537 GGTTGAGAGGGGCCCCAAGCTGG + Intergenic
1121408216 14:93732325-93732347 GCCTGTGGGGCTCCCCAAGCTGG + Intronic
1121629866 14:95414168-95414190 GCTGGAGGGGGGCTTCAGGCTGG - Intronic
1121713953 14:96059631-96059653 TCTGCTGGGGGGGCCCTAGCTGG + Intronic
1122736978 14:103848464-103848486 CCATGTGGGGGGCCCCGAGCGGG - Intergenic
1122864237 14:104596347-104596369 GCTTGTGGGGGGCCCCAGAGTGG - Intronic
1122937948 14:104968490-104968512 GCTGGTGGGAGTCCTCAATCTGG - Intronic
1123044157 14:105503275-105503297 GCTGGTGAGGGGCCCGGGGCTGG + Intergenic
1124351138 15:28956339-28956361 GATGGGGTGGGGTCCCAAGCAGG + Intronic
1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG + Intergenic
1127279383 15:57475908-57475930 GCTGCTGGGTGGACCCAAGAAGG - Intronic
1127287961 15:57547128-57547150 GCTGGTGGGGTGGGCCAGGCTGG - Intronic
1127791915 15:62405715-62405737 GCTGGTGGGGAACCAGAAGCTGG + Intronic
1127857839 15:62967279-62967301 GCTGGGGAGGGGCCCAGAGCAGG + Intergenic
1128808800 15:70555139-70555161 GCTGGTGGGTGATCCCAAGGTGG + Intergenic
1129526072 15:76215418-76215440 GCTGGGGAAGGGCCCCAGGCTGG + Exonic
1130352961 15:83107625-83107647 GCTGGGGCGGGGCGCCCAGCGGG + Exonic
1131510387 15:93046701-93046723 GCTGAAAGGGGTCCCCAAGCTGG + Intronic
1132500495 16:282706-282728 GCTGGTGCGGGGCCCCTATCTGG + Exonic
1132688055 16:1170516-1170538 GCTTGTGGGGGTCCGCAGGCCGG - Intronic
1132741295 16:1414580-1414602 GCGGGCGGGGGGCCGCAGGCCGG + Intronic
1132775544 16:1591727-1591749 GCTGGCCGGGGGCCTCAGGCTGG + Intronic
1132958068 16:2606898-2606920 GCGGGTGGTGGGTCCCAAGCTGG - Intergenic
1132970542 16:2686146-2686168 GCGGGTGGTGGGTCCCAAGCTGG - Intronic
1133512646 16:6474609-6474631 GATGGTGTGGTGCCCCAAGTGGG + Intronic
1139549032 16:67663377-67663399 GCTGGAGGGGGGCCCCACTGGGG - Intronic
1139750496 16:69106628-69106650 GCCGGTGCGGGGCTCCAGGCTGG + Intronic
1141096492 16:81166485-81166507 GCTGGTGCGGGGACCCAGGAAGG + Intergenic
1141682669 16:85553527-85553549 GCTGGGAGGGGGCGCCAGGCGGG + Intergenic
1142474328 17:180624-180646 GCTGGGGAGGGGCCCGAGGCTGG - Intronic
1142985172 17:3690976-3690998 GCTGGTTGGGGGTCACAATCAGG + Exonic
1143121098 17:4607403-4607425 GATGGTGATGGGCCGCAAGCCGG + Exonic
1143472512 17:7184839-7184861 GCTGATGGAGGGCCTCAGGCTGG - Intergenic
1144743787 17:17599680-17599702 GCTGGTGGGGGCCACCACACCGG + Intergenic
1144743972 17:17600788-17600810 GCTGGTGGGGGCCACCACACCGG - Intergenic
1144754330 17:17669995-17670017 GCAGGTGGGAGGCCTCAATCGGG - Intergenic
1146482561 17:33216735-33216757 GGTGATGGGGAGCCCCAAGAGGG + Intronic
1147526975 17:41234482-41234504 GCTGGTAGGAGGCCCCAAGAAGG - Intronic
1147528099 17:41246162-41246184 GCTTGTAGGAGGCCCCAAGAAGG - Intronic
1147661121 17:42117634-42117656 GTTGGTGGGGGTCCCCCAACTGG + Intronic
1148438700 17:47700800-47700822 GTTGGTGGGGGGCCCAGTGCTGG + Intronic
1148607852 17:48943897-48943919 TCGGTTGGGGGGCCCCAGGCAGG - Intronic
1148758647 17:49987869-49987891 GCTTGTGGGGGGCCCCCATCAGG + Intergenic
1148774467 17:50087889-50087911 GCTGGTGGAGGTCCCGGAGCAGG - Intronic
1148818282 17:50346167-50346189 GCTGGTGCGGCGCTACAAGCTGG + Exonic
1148875982 17:50687488-50687510 GCAGGTGGGAGGCCCCCAGCTGG + Intronic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1149867008 17:60156720-60156742 GCTGGATGGAGGCCCCAGGCAGG + Intronic
1151478534 17:74356833-74356855 GCTGGTGGGGGCGCGCCAGCAGG - Exonic
1152067491 17:78119534-78119556 CCTGGTGGGGTCCCCCAGGCTGG - Intronic
1152900417 17:82937909-82937931 GCGGGCCTGGGGCCCCAAGCCGG - Intronic
1152919361 17:83058194-83058216 GCTGGTGCGGCTCCCCAGGCCGG - Intergenic
1154439774 18:14378634-14378656 GCAGGTGGGGGCCCCCGAGGAGG - Intergenic
1155229283 18:23757366-23757388 GCTGCTGGAGAGCGCCAAGCAGG - Intronic
1156473695 18:37392998-37393020 GCTGGTGTCAGGCCCCATGCTGG - Intronic
1157248032 18:46071226-46071248 GGTGGTGGGGGGAGGCAAGCAGG + Intronic
1157538342 18:48478371-48478393 GCTGGTGCATGGCTCCAAGCAGG - Intergenic
1157586659 18:48805397-48805419 ACTGGTGGGGGGGACCAAGGAGG + Intronic
1157696872 18:49730082-49730104 GCTGGTGGGGGACCCACATCTGG + Intergenic
1160693566 19:471552-471574 GCTGCTGGGGAGGCCCAGGCAGG - Intronic
1160706378 19:532062-532084 GGTGTTGGGGGGCCCGAAGATGG - Exonic
1160832455 19:1110140-1110162 GGTGCTGGGTGACCCCAAGCAGG + Intronic
1160966965 19:1750898-1750920 GCTGGTGGGGAGAAGCAAGCTGG + Intergenic
1161210150 19:3061887-3061909 GGGGGGGGGGGGCGCCAAGCCGG + Intronic
1161482205 19:4516856-4516878 GCTTGGGGGGAGCCCCCAGCGGG - Intronic
1161513228 19:4683148-4683170 GCGGCGGGGGGGCCCCAGGCCGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162721959 19:12667983-12668005 CCTGGTGTGGGGCCCCAGTCTGG - Intronic
1162727820 19:12700636-12700658 GTGGGTGGGGGGCCTCAGGCGGG - Exonic
1163088773 19:15003405-15003427 GATGGTGGGAAGCCCCAGGCTGG - Intronic
1163243190 19:16076707-16076729 GCGGGTGCGGGGCCCGAGGCCGG - Intronic
1163665890 19:18604020-18604042 TCTGTTGGGGGGGCCCAGGCAGG - Intronic
1163666448 19:18606130-18606152 GCTGGGTGCGGGCCCCCAGCGGG - Intronic
1164286224 19:23820099-23820121 GCTTATGGGTTGCCCCAAGCAGG - Intronic
1164682312 19:30144135-30144157 GCTGGAGGAGGTCCCCAACCTGG - Intergenic
1165783754 19:38448654-38448676 GCTGGATGTGGCCCCCAAGCGGG + Exonic
1165803198 19:38565432-38565454 CCTGGTGGAGGGCGCCAAGAAGG + Exonic
1166735085 19:45079290-45079312 GGTGGTGGGGGGTCGCCAGCAGG + Exonic
1167148222 19:47694964-47694986 GCTGGTGAGGGGCCCCAGGCTGG - Exonic
1202683543 1_KI270712v1_random:30227-30249 GCGGGTGGGGGGCAAAAAGCCGG - Intergenic
924991387 2:315776-315798 GGTGGTGAGGGACCCCCAGCAGG - Intergenic
925046088 2:773937-773959 GCTGGGTGGGGGCACCAGGCTGG - Intergenic
926088715 2:10036378-10036400 GGAGGTGGGGAGGCCCAAGCCGG - Intergenic
928798988 2:35063880-35063902 GCTGTTCGGGGGGCCGAAGCAGG - Intergenic
930211798 2:48646910-48646932 GCTGGTGGAGAGCCCCATGAGGG - Exonic
933777314 2:85778982-85779004 GCTGGAGGGGGCACTCAAGCAGG - Intronic
933777343 2:85779068-85779090 GCTGGAGGGGGCACCCAGGCTGG - Intronic
934068760 2:88364519-88364541 GCTGATGGCTGGCCCCAGGCAGG - Intergenic
934665627 2:96167999-96168021 TCTGGTGGGGTGCCCCCAGGAGG - Intergenic
936038279 2:109129471-109129493 GCCGGTGGCGGGCTCCACGCCGG + Intronic
937446611 2:121963507-121963529 GCTGGGGGGAGGCCCCAGCCTGG + Intergenic
938072930 2:128317909-128317931 GCGAGTGGGGGCCCCCAAGAGGG + Intronic
938252843 2:129828887-129828909 GATGCTGGGGGGCCTCCAGCTGG + Intergenic
938256469 2:129863410-129863432 GTGGGTGGGGTGCCCCAATCTGG + Intergenic
942560420 2:177213024-177213046 GCGGGCGAGGGGCCCCAAGGAGG - Intronic
947718313 2:232352676-232352698 GCTGGTGGGCGGCTCCGAGTGGG - Intergenic
948217200 2:236240550-236240572 GCGGGTGGGGTGCCCAAAGCAGG + Intronic
948348670 2:237320734-237320756 GCTGAGGGGTGGCCCAAAGCTGG + Intergenic
948615949 2:239199097-239199119 GGTGGTGGGGGGCAGGAAGCAGG - Intronic
948900857 2:240956250-240956272 GCTCATGGGAGGCCCCCAGCTGG - Intronic
1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG + Intergenic
1169122706 20:3106973-3106995 GCCGCTGGGAGGCCTCAAGCTGG + Intergenic
1172367889 20:34363680-34363702 GCTGGAGAGTGGCCCCAGGCGGG - Intronic
1175256732 20:57652394-57652416 GCTGCTCGGGGTCCCGAAGCTGG + Exonic
1175657026 20:60779818-60779840 CCTGGTGAGAGACCCCAAGCTGG + Intergenic
1176455970 21:6911139-6911161 GCAGGTGGGGGCCCCCGAGGAGG + Intergenic
1176834144 21:13776187-13776209 GCAGGTGGGGGCCCCCGAGGAGG + Intergenic
1178724309 21:35037452-35037474 GCTGTGGGGTGGCACCAAGCTGG - Intronic
1179921841 21:44511830-44511852 GGTGATGGGGGACCCCGAGCTGG + Intronic
1179935663 21:44602213-44602235 GCGGGTGGGGGGCATCAGGCAGG - Intronic
1180162038 21:46002432-46002454 GCTGGCGGGGCGCCCTAGGCGGG - Intronic
1180931262 22:19593455-19593477 GTTGGAGGCGGGCCCCAATCTGG + Intergenic
1181024172 22:20117996-20118018 ACTAGTGGGGAGCCCCAAGTGGG - Intronic
1181111327 22:20604608-20604630 GCTGGCTGGGGGCCCTAAGATGG + Intergenic
1181793048 22:25282798-25282820 GCTGGTGGGGCGCGCCGAGCAGG + Intergenic
1182257730 22:29050417-29050439 GCGGGTGGGGAGCCCCAGTCAGG + Exonic
1183481439 22:38067730-38067752 GCTGCAGGCGGACCCCAAGCAGG + Exonic
1184248824 22:43248965-43248987 CCTGAGGGGGGGCACCAAGCTGG + Intronic
1184276352 22:43411616-43411638 GCTGGGGGCGGGCGCCAAGAGGG + Intronic
1184473588 22:44709177-44709199 GGTGGTGGGGAGCCACAAGCAGG - Intronic
1184616501 22:45641507-45641529 GCAGGTGTGGGGTCCGAAGCAGG + Intergenic
1184707571 22:46224969-46224991 GCTGGGGGGGGGCCTGAAACCGG + Intronic
1185171230 22:49295808-49295830 GCTGATGGGGCGGCGCAAGCCGG + Intergenic
1185180565 22:49358437-49358459 GCTGCTGGGGGGCCCCTTTCTGG - Intergenic
1185343744 22:50302559-50302581 GAAGGTGGGGCGCCCCAGGCAGG - Intronic
1185380265 22:50504661-50504683 GCTGGTGGGGCACCACAACCGGG + Exonic
950044907 3:9943333-9943355 GCTGGGTGGGGGGCCCTAGCAGG + Intronic
950090458 3:10290961-10290983 GGTGGCGGGGTGCCCCAAGTGGG + Exonic
952900937 3:38111446-38111468 GCTGGCGGGTGGCCCGCAGCTGG + Intronic
953907310 3:46874831-46874853 ACTGGTTGGGGGTCCAAAGCGGG - Intronic
953981010 3:47412977-47412999 GGAGGAGGGGGGCCCCGAGCTGG - Exonic
954298580 3:49687316-49687338 GCTGGGGGAAGGCCCCAGGCCGG + Intronic
954380365 3:50215896-50215918 GAGGGTGGGGGGGCCCAGGCTGG + Intronic
954878663 3:53819606-53819628 CCGGGTGGGGGACCCCAGGCTGG + Exonic
955633897 3:61004700-61004722 GCCAATGGGGGGACCCAAGCAGG - Intronic
956277660 3:67520532-67520554 GCTGGTGGGCAGCCCCCAGGGGG - Exonic
956587133 3:70876900-70876922 GCGGGTGGGGGGCCTGTAGCAGG + Intergenic
956749620 3:72335618-72335640 CCTAGGGGGTGGCCCCAAGCTGG + Intergenic
957598916 3:82306513-82306535 GCTGATGGATGACCCCAAGCAGG - Intergenic
961387342 3:126530046-126530068 GCTGGGGGCTGGCCCCAAACAGG - Intronic
961475348 3:127142548-127142570 ACAGGTGGAGGGCCCCAGGCCGG + Intergenic
961477261 3:127156736-127156758 GCTGGTGGAGGGCCACAGGAGGG - Intergenic
962061187 3:131929421-131929443 ACTGGAGGGGGTCCCCAAGAAGG - Intronic
962842939 3:139252022-139252044 GCTGAGGGGTGTCCCCAAGCTGG - Intronic
965719282 3:171644008-171644030 TCTGGCGAGGGGGCCCAAGCAGG + Intronic
967828862 3:193901712-193901734 GCAAGTGTGAGGCCCCAAGCAGG - Intergenic
968092936 3:195909483-195909505 GCCGGTCGGGGGCCCCCGGCGGG - Intronic
968481216 4:833872-833894 GCTGGATGGGGCCCCCGAGCCGG + Intergenic
968517344 4:1020793-1020815 GCTGGGGTGGGGACCCAGGCAGG + Intronic
968619369 4:1596975-1596997 GCTGGAGGGAGGCCCCGAGGAGG - Intergenic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
968829580 4:2926060-2926082 GCGGGTGGGGGACCGCAGGCTGG - Exonic
969301284 4:6298912-6298934 GCTGATGGGGGGCTCCAGCCTGG + Intronic
969563971 4:7966850-7966872 GCGGGAGGGGGTCCCCCAGCAGG - Exonic
971972089 4:33633888-33633910 CCTGGTGGGAGGCCCCATGGGGG + Intergenic
972683136 4:41326160-41326182 GCTGTTTGGGGGTCCCAAGGAGG - Intergenic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
980695995 4:136356192-136356214 GCAGGTGGGGGCGCCCAAGGAGG - Intergenic
980839905 4:138245869-138245891 GCTGGTGGGGGGACACAAATTGG + Intergenic
985745932 5:1647744-1647766 GATGCTGGTGGGCACCAAGCAGG - Intergenic
992888624 5:81183751-81183773 GCTCCTGTGGGGCCCCAAGCTGG + Intronic
993646945 5:90474172-90474194 GCTGGTGCGCGGCTCCGAGCAGG - Exonic
993703454 5:91144158-91144180 GCTGGTGGGGGGCTGGCAGCAGG - Intronic
997297449 5:132777021-132777043 GCTGGCGGGGGGCGCGAAGCGGG - Intronic
997670675 5:135669332-135669354 GCTGGTGGGAGAACCCAAGAAGG - Intergenic
1001780111 5:174360997-174361019 GAAGGTGGGGGGCTCCACGCTGG + Intergenic
1002347376 5:178557445-178557467 ACTGGCGGGGGGCCCTGAGCTGG - Intronic
1002597601 5:180334444-180334466 GTGGGTGGGGGACACCAAGCAGG + Intronic
1003097500 6:3154376-3154398 GCTGGTCAGGGGCGCGAAGCCGG + Exonic
1003101087 6:3177096-3177118 GCTGGTCAGGGGCGCGAAGCCGG + Intergenic
1003107040 6:3225264-3225286 GCTGGTCAGGGGCGCGAAGCCGG + Exonic
1006024504 6:31138581-31138603 GCTAGTGGGGTACCCCAACCAGG - Intronic
1006114810 6:31769922-31769944 GGTGGTGGGGAGCCCCAGGAGGG + Intronic
1006334062 6:33411236-33411258 GCTGGTGGGGGGCAGGGAGCCGG + Intronic
1006441628 6:34057026-34057048 GCTGGTGGGGCTGCCCAACCCGG + Intronic
1007549156 6:42715862-42715884 GTTTCTGGGGGGCCCCAAGGAGG + Intronic
1007600321 6:43076996-43077018 GCTGGTTTGGGGCCCGATGCCGG + Intronic
1007806531 6:44454138-44454160 GCTGGTGTGGTGGCCCATGCCGG + Intergenic
1008116059 6:47551711-47551733 GCTTGTGTGGGGCCCTTAGCTGG + Intronic
1014570891 6:123006156-123006178 GCTGGTGGCGGGCCCAGAGGAGG + Intronic
1017643453 6:156516638-156516660 GGTGGTGGAGGGCACCAAGGTGG - Intergenic
1018359661 6:163054735-163054757 GCTGGTGGGAAGCCCCAAAATGG - Intronic
1018742739 6:166743151-166743173 GCTGGTGGGGGCCACGGAGCTGG - Intronic
1019438490 7:1033955-1033977 GCTGGCCGGGGGCCACAGGCAGG + Intronic
1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG + Exonic
1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG + Intronic
1033683654 7:143620494-143620516 GCCGGTTTGGGGCCCCATGCAGG + Intergenic
1033700958 7:143837144-143837166 GCCGGTTTGGGGCCCCATGCAGG - Intergenic
1034410998 7:150942170-150942192 CCTGGCGCAGGGCCCCAAGCTGG - Intergenic
1035028802 7:155844253-155844275 GCTCGAGGGAGGCCCCTAGCTGG - Intergenic
1035264796 7:157684880-157684902 GCGCGCGGGGGGCCCCAGGCGGG + Intronic
1037801867 8:22040381-22040403 GCCAGTGGTGGGCCCCAAGTGGG - Intergenic
1041775623 8:61519750-61519772 GATGGAAGGGGGCCACAAGCCGG + Intronic
1042039629 8:64578163-64578185 ACTGGTGGGGGGTGCCATGCGGG - Intergenic
1042829267 8:73009033-73009055 GCAGGTGGGGGCCCCCGAGGAGG + Exonic
1049731475 8:144180673-144180695 GCTGGTTGGGGGGCCCATGTGGG + Intronic
1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG + Exonic
1051592556 9:18791242-18791264 TCTGGAGGGGGGTCCCATGCAGG - Intronic
1054455366 9:65427527-65427549 GCGGGTGGGGGCTCACAAGCTGG - Intergenic
1058671998 9:107367686-107367708 GCTGGCTGGGAGCCCCAAGAAGG - Intergenic
1059437300 9:114284487-114284509 GATGGTTGGGGGCCCCACCCTGG - Intronic
1060047014 9:120349287-120349309 GCTGGTGGGTGGCAGCGAGCTGG - Intergenic
1060155082 9:121313930-121313952 ACAGGTGCTGGGCCCCAAGCCGG + Exonic
1060586352 9:124788690-124788712 CCTGGTGGGGGGCCCTAGTCTGG - Intronic
1061152490 9:128836769-128836791 GCAGGGGAGGGGCCCCAGGCTGG + Intronic
1061192523 9:129089960-129089982 GTTTGAGGGGGACCCCAAGCAGG - Exonic
1061925939 9:133806109-133806131 GATGGTGGGGGGCAGCACGCTGG - Exonic
1061950778 9:133934769-133934791 GGAGGTGGAGGGCCCCCAGCAGG - Intronic
1062239303 9:135527088-135527110 TCTGGTGGCTGCCCCCAAGCTGG - Intergenic
1062439512 9:136563443-136563465 GCTGGTGGGGGGCCCACTGCTGG - Intergenic
1186938220 X:14474611-14474633 GCTGGTGGGTGGGCTGAAGCTGG + Intergenic
1192318233 X:70067875-70067897 GCTGGGGAGGGGCAACAAGCTGG + Intergenic
1193021289 X:76796721-76796743 GGTGGTGGGGGGCAGCTAGCTGG - Intergenic
1193359304 X:80561589-80561611 CTTGGTGGGGGTCCCCAAGGAGG - Intergenic
1193620688 X:83749957-83749979 GCAGGTGGGGGCCCCCCAGGAGG - Intergenic
1194091822 X:89586910-89586932 GTGGGTCTGGGGCCCCAAGCCGG - Intergenic
1195907832 X:109863110-109863132 GCTGGTGAGAGCCCCAAAGCTGG + Intergenic
1196812056 X:119636681-119636703 GCTGGGGGGAATCCCCAAGCTGG - Intronic
1199679070 X:150213138-150213160 GCAGGGGGTGGGCCCCAAGCTGG + Intergenic
1200065384 X:153502146-153502168 GGTCCTGGGGGGCTCCAAGCTGG + Intronic
1200444462 Y:3242976-3242998 GTGGGTCTGGGGCCCCAAGCCGG - Intergenic
1202370826 Y:24194432-24194454 GCTGGGAGGGGGCCACAGGCAGG - Intergenic
1202499958 Y:25475685-25475707 GCTGGGAGGGGGCCACAGGCAGG + Intergenic