ID: 1091254134

View in Genome Browser
Species Human (GRCh38)
Location 11:134168797-134168819
Sequence CACAGTAAAGACCTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091254126_1091254134 -9 Left 1091254126 11:134168783-134168805 CCATCCTGCCAAGCCACAGTAAA 0: 1
1: 0
2: 3
3: 18
4: 236
Right 1091254134 11:134168797-134168819 CACAGTAAAGACCTGGGGCAGGG 0: 1
1: 1
2: 2
3: 26
4: 232
1091254125_1091254134 28 Left 1091254125 11:134168746-134168768 CCTTAGGAAGCGATTCTCACGAC 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1091254134 11:134168797-134168819 CACAGTAAAGACCTGGGGCAGGG 0: 1
1: 1
2: 2
3: 26
4: 232
1091254124_1091254134 29 Left 1091254124 11:134168745-134168767 CCCTTAGGAAGCGATTCTCACGA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1091254134 11:134168797-134168819 CACAGTAAAGACCTGGGGCAGGG 0: 1
1: 1
2: 2
3: 26
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091254134 Original CRISPR CACAGTAAAGACCTGGGGCA GGG Intronic
900533519 1:3166067-3166089 AACAGGAAAGACCAGGGGCTAGG - Intronic
900569197 1:3350041-3350063 GGCAGAAAAGACCTGGGGCCAGG + Intronic
900991999 1:6102385-6102407 CACAGAAGAGACTTGGGGGAGGG + Exonic
903230761 1:21921067-21921089 CACAATTAATACCTGGGGAATGG - Intronic
903270661 1:22186215-22186237 CACAGGAAACACCTGGTTCAGGG - Intergenic
904869726 1:33608909-33608931 CACAGGAAAGCCTTGGGGGAAGG + Intronic
905982307 1:42241014-42241036 AACAGGAAACACCTGAGGCAGGG + Intronic
906137474 1:43509550-43509572 CCAAGTAAAGACCGGGGGGAAGG + Intergenic
906495293 1:46301369-46301391 CTCAGAAAAGTCCTAGGGCATGG - Intronic
907575153 1:55519773-55519795 CAGAGGAAAGAACTGGGGCTGGG - Intergenic
911580883 1:99631874-99631896 AACAGTGAAGACATGGGGTAGGG + Intergenic
913441146 1:118899009-118899031 CAAGGTAAAGCCCTGGAGCAAGG - Exonic
913485576 1:119329976-119329998 CAGAGAAAAGACCCGGGGCCGGG + Intergenic
914406904 1:147384348-147384370 AACTTTAAAGACCTGGGACAGGG + Intergenic
915319583 1:155048983-155049005 CTCAGTGAAGACCTTGGCCAAGG - Intronic
915590627 1:156868329-156868351 CACTGAAAAGGCCTGGGGAATGG + Intronic
915723006 1:157997615-157997637 CTCAGAAAAGATCTGGGGAAGGG + Intronic
916624860 1:166544429-166544451 CACAATAAAGAGCTGGGGACTGG - Intergenic
916679253 1:167089250-167089272 CACAGGAAAGCCCCGGGCCACGG - Intronic
916750794 1:167721668-167721690 CCCAGCAAAGACCTGTGGCGAGG + Intronic
918084057 1:181230260-181230282 CACCGGAAGGACCTTGGGCAAGG - Intergenic
919837109 1:201582584-201582606 CACAGAGAAGAGCTGGGGAATGG + Intergenic
920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG + Exonic
922876157 1:228941363-228941385 CAGGGTGAAGTCCTGGGGCAGGG - Intergenic
923447034 1:234081458-234081480 CAGAGTCAGGACCTGGGGGAGGG + Intronic
924450578 1:244175208-244175230 CACAGTAGAGATCTGTTGCAAGG + Intergenic
1062897580 10:1116146-1116168 CAGAGTGGAGACCTGGGGCGGGG - Intronic
1063307633 10:4920047-4920069 TAGAGTAAAAACCTGGGGAAAGG - Intergenic
1067430991 10:46245774-46245796 CACAGTAAGGACCTGGAGCCAGG + Intergenic
1067442417 10:46316454-46316476 CACAGTAAGGACCTGGAGCCAGG - Intronic
1068338374 10:55667696-55667718 CACTGTCAAGAACAGGGGCAAGG - Intergenic
1068732790 10:60377713-60377735 CAGAATAAAGGCCAGGGGCAGGG + Intronic
1069718308 10:70534535-70534557 GACAGCAAAGGGCTGGGGCAGGG + Intronic
1070752008 10:78969390-78969412 CTAAGTAGAGACCTGAGGCATGG - Intergenic
1072449773 10:95530755-95530777 CTCAGTACAGACCTGTGGGAAGG - Intronic
1073194196 10:101674798-101674820 CACAGACAAGTCCTGTGGCAGGG + Intronic
1075354709 10:121760996-121761018 CAGATTAATGACCTGGAGCAGGG + Intronic
1076248772 10:128967956-128967978 CACAGGAAAGCCTTGGGTCAGGG - Intergenic
1076694033 10:132238396-132238418 CACAGCAAAGACCAGGGTCTCGG + Intronic
1077435605 11:2537479-2537501 CACTGTAGAAACGTGGGGCACGG - Intronic
1078182700 11:9026056-9026078 CACCTGAAAGACCTGGGGCTTGG + Intronic
1079419744 11:20274954-20274976 CACAGCAAAGACCTGGTGTCTGG - Intergenic
1080049757 11:27847451-27847473 CACAGTTAGGACCTGGGGAAGGG + Intergenic
1080069355 11:28060826-28060848 CCCAATAAAAACCTGGGACATGG + Intronic
1081742889 11:45453311-45453333 CACTGTAAAGCCCAGAGGCAAGG + Intergenic
1082806011 11:57451053-57451075 CTCAGGCAAGACCTGGGGAAGGG + Intergenic
1083408815 11:62477836-62477858 CCCAGTCAAGCCCTGGGCCAAGG + Intronic
1083529600 11:63407674-63407696 CACAGTATTGACATGGGGCTAGG - Intronic
1084972101 11:72777642-72777664 CACAGTGCAGCCCTGGGGCCAGG + Intronic
1085442617 11:76578130-76578152 CACATTTAAGAGCTGGGGCCTGG + Intergenic
1087162750 11:94965676-94965698 CCCAGTAAAAACCTTGGGCGCGG + Intronic
1089828406 11:121300983-121301005 CAACTTAAAGCCCTGGGGCAGGG + Intronic
1090799449 11:130161169-130161191 CACAGACAGGACCTGGGGCTGGG + Intronic
1091254134 11:134168797-134168819 CACAGTAAAGACCTGGGGCAGGG + Intronic
1092570755 12:9719103-9719125 CACATTAAAGACCTAGGAGAAGG - Intronic
1093795925 12:23310480-23310502 CACACTAAAGACCTAGAACAAGG + Intergenic
1094454373 12:30616056-30616078 CAAAGCAGAGCCCTGGGGCAAGG + Intergenic
1095792469 12:46182396-46182418 CAAAGTAGAAACCTGGGGTACGG - Intergenic
1096201127 12:49683993-49684015 CACAGTAGAGAGGTGGGGCTTGG - Intronic
1096836218 12:54352967-54352989 CACAGCATTGACCTGGGGGAGGG + Intergenic
1097234430 12:57529521-57529543 CAAATAAAAGACCTGGGGAAGGG - Exonic
1098644553 12:72881983-72882005 AACAGGGAAGAGCTGGGGCATGG + Intergenic
1099718654 12:86332191-86332213 CACAGTAAAGACTTTTGTCACGG + Intronic
1100999795 12:100345992-100346014 CACTTTATAGACGTGGGGCAGGG + Intergenic
1101490797 12:105207652-105207674 CAGAGTCAACACTTGGGGCAAGG + Intronic
1102012622 12:109627973-109627995 CAGAGTCAAGACCTGAGTCATGG + Intergenic
1102578192 12:113870453-113870475 CACAGTACAGGACTGGTGCAAGG - Intronic
1102901571 12:116642173-116642195 CACAGTAAAAACCTGGAGGGTGG - Intergenic
1103206751 12:119135605-119135627 CTCAGTAAACACCTGGTGCATGG - Intronic
1105899964 13:24745574-24745596 CACAGCAAGGACCAGGAGCACGG + Intergenic
1105984407 13:25551284-25551306 CACAGAACAGATTTGGGGCAAGG - Intronic
1106035534 13:26041329-26041351 GACAGGAAAGACCTGGGTCTGGG - Intergenic
1106182241 13:27379929-27379951 CACAGGCAAGGACTGGGGCAAGG + Intergenic
1111199537 13:84915583-84915605 CACAGTGTAGCACTGGGGCAGGG - Intergenic
1111335751 13:86820036-86820058 CACAGTTAAGACCTGAAGCATGG - Intergenic
1111849227 13:93551279-93551301 AACAGTAAAGGGCTGGTGCAAGG - Intronic
1115907114 14:38211871-38211893 CAAAGAAAAGACCTGGGGCTAGG - Exonic
1116012548 14:39367639-39367661 GACAGGAAATACCTGAGGCATGG - Intronic
1116811775 14:49546489-49546511 AACAGATAAAACCTGGGGCAAGG + Intergenic
1117348145 14:54854351-54854373 CCCAGCAAAGACCTGCAGCAGGG + Intronic
1118495531 14:66304955-66304977 CACAGAGAAGAACTGGGGCAGGG + Intergenic
1118726981 14:68635779-68635801 CACACTAAGAACCTAGGGCAAGG + Intronic
1119114759 14:72009057-72009079 CTCAGTAAAAACCTTGGGCCAGG + Intronic
1121677736 14:95767918-95767940 CACAGGCAAGACCATGGGCATGG - Intergenic
1122023794 14:98859925-98859947 CTCAGGAAAGACCTGAGCCAGGG + Intergenic
1122964708 14:105117161-105117183 CACAGAAGAGACCTGAGGGAGGG + Intergenic
1127715456 15:61645016-61645038 CACAGTAAACACCTGGTCAATGG + Intergenic
1131964040 15:97819597-97819619 CAAAAGAAATACCTGGGGCAGGG + Intergenic
1139530726 16:67541506-67541528 CACAGCCACAACCTGGGGCAGGG - Exonic
1140174656 16:72645257-72645279 GAAAGTAAAGACCTCTGGCAGGG + Intergenic
1140307021 16:73812511-73812533 CATAATAAAGAGATGGGGCAGGG + Intergenic
1142291624 16:89195942-89195964 CAAAGTCAAGGCCTGGGGCATGG - Exonic
1142699495 17:1650437-1650459 CTCAGTGGAGACCTGAGGCAGGG - Intergenic
1143410034 17:6703188-6703210 CAGAGTCAGGACCTGGGGCTGGG - Intronic
1143543984 17:7585752-7585774 CTCAGCAAAGGCCTGGGGCTGGG + Exonic
1143699385 17:8646907-8646929 CACAGTAAAACCATGGGGAAGGG - Intergenic
1146270108 17:31479443-31479465 CACAGTAATCACCTGGGGAATGG - Intronic
1146354819 17:32125106-32125128 CACAGTAAAGAACTGCAGCAGGG - Intergenic
1146489903 17:33273464-33273486 CACAGGAAGGACCTGGGAGAGGG + Intronic
1147034672 17:37671197-37671219 CATAGTGAAATCCTGGGGCAAGG - Intergenic
1147512329 17:41081704-41081726 CCCAGCAAAGCCATGGGGCAGGG + Intergenic
1147514502 17:41102875-41102897 CCCAGCAAAGCCATGGGGCAGGG + Intronic
1147787588 17:42990914-42990936 AACAGCAAAGATCTGGAGCACGG - Exonic
1151232488 17:72694761-72694783 CAGAGAGAAGACCTGGGGCTGGG + Intronic
1152452203 17:80388770-80388792 CACAGCAAACACCCGGGGCAAGG - Intronic
1152508817 17:80771577-80771599 CAGGGTAAACACCTGGGGCTGGG - Intronic
1152671862 17:81613008-81613030 CACAGTAAAGACTTGGTGTGAGG + Intronic
1153799518 18:8657202-8657224 CACAGTGAGGGCCCGGGGCAAGG + Intergenic
1153937261 18:9939639-9939661 CACAGGAAATACCAGGGACAGGG - Intronic
1155170912 18:23266312-23266334 CACAGTAAACCCCTGGCCCAGGG + Intronic
1155727388 18:29104879-29104901 CATAGTAAAGATCGGGGGAAGGG + Intergenic
1155993444 18:32304760-32304782 CAGAGTCAATGCCTGGGGCAGGG + Intronic
1156394899 18:36690591-36690613 CACCGTAAATGCCTGTGGCATGG + Intronic
1157210475 18:45737868-45737890 CACAGTGCTGATCTGGGGCAGGG + Intronic
1157441047 18:47711877-47711899 AACAGGAAAGACCTGTGGCCTGG - Intergenic
1158097112 18:53785774-53785796 CACAGGAAAGATCAGAGGCATGG + Intergenic
1158732347 18:60037980-60038002 CACAGGAAAGACTGGGGGCACGG + Intergenic
1159865773 18:73702973-73702995 GACAGTAAAGAGCTGGGAGAGGG - Intergenic
1161646592 19:5456774-5456796 GTCAGTAAAGATCTAGGGCAGGG + Exonic
1162726290 19:12691373-12691395 CACAGTGAAGCTCTGGGACATGG - Exonic
1164583120 19:29447381-29447403 CACAGTGAGGGACTGGGGCAGGG - Intergenic
1164684929 19:30160349-30160371 CAGGGTGAAGTCCTGGGGCAGGG - Intergenic
1165950692 19:39472665-39472687 CATAGGAAAGCCATGGGGCAGGG + Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1168151688 19:54452472-54452494 CACGTTAGAGACCAGGGGCATGG - Intronic
925591163 2:5511421-5511443 CACAGTAAGGACATGGGTGAAGG - Intergenic
925750961 2:7090290-7090312 CTGAGGAAAGGCCTGGGGCAGGG + Intergenic
928636275 2:33250464-33250486 CACAGGAAACACCTAAGGCAGGG + Intronic
928732095 2:34243296-34243318 CAGAGTAAAAACAAGGGGCAAGG + Intergenic
928877731 2:36060392-36060414 ACCAGTAAAGACCTGAGGGAAGG + Intergenic
930042858 2:47141853-47141875 CACACTGAACACCTGGGGGAGGG + Intronic
932037116 2:68256989-68257011 AACAGTAAAGACCTGGGGCAAGG + Intronic
932430127 2:71669101-71669123 CGCAGGAAAAACCTGGGGAAAGG - Exonic
936122345 2:109757592-109757614 CACATTCAGGCCCTGGGGCATGG - Intergenic
936222348 2:110613882-110613904 CACATTCAGGCCCTGGGGCATGG + Intergenic
936398735 2:112150004-112150026 CACATCAAAGACCAGAGGCATGG + Intronic
939652438 2:144781047-144781069 CAGATTGAAGCCCTGGGGCATGG + Intergenic
940009601 2:149039285-149039307 AAAAGTAAAGAGCCGGGGCAAGG - Intronic
943372031 2:187027919-187027941 CACAGGAAAGACCTGCGCCAAGG + Intergenic
944149722 2:196544810-196544832 AACAGTAAAGAACAGGGGCTGGG + Intronic
944183722 2:196926040-196926062 CAAAGGAAGGTCCTGGGGCACGG + Intronic
945090059 2:206169872-206169894 CACAGGAAAGACCTGCCCCATGG - Intergenic
945627303 2:212226397-212226419 CATAGTAAAGACATGGGGGGGGG + Intronic
946483586 2:220079387-220079409 CACAGTGAGGACCTGTGACAGGG + Intergenic
948662205 2:239514559-239514581 CACAGTAAGAACCTGGGTCTTGG - Intergenic
948760316 2:240186205-240186227 CACAGTGATGACCTGGCCCACGG + Intergenic
1169087743 20:2837912-2837934 AACAGGAAAGAAATGGGGCATGG - Intronic
1171396483 20:24837161-24837183 CACAGTCAAGCCCCAGGGCAAGG + Intergenic
1172913577 20:38427903-38427925 CCCAGTAAACACCCCGGGCATGG + Intergenic
1174871469 20:54186451-54186473 CTCAGTAATAACCGGGGGCAGGG + Intergenic
1176117994 20:63441536-63441558 CCCACAAAAGACCTGGGGGATGG + Intronic
1179478919 21:41665714-41665736 GACAGGGAAAACCTGGGGCAAGG - Intergenic
1179882272 21:44297909-44297931 CAGAGTAGAGAAGTGGGGCAGGG - Exonic
1179958955 21:44757711-44757733 CACAGTAGAGAGCTGGGGGGTGG + Intergenic
1180946484 22:19696460-19696482 CACAGCAGAGGCCTGGGGCCAGG - Intergenic
1181801802 22:25352512-25352534 CACGGTAACGGCTTGGGGCAGGG + Intronic
1182474298 22:30568003-30568025 CCCAGTAAATACCTGTGGGATGG - Intronic
1182743217 22:32584031-32584053 CAGAGTAAAGTCATGGGACAGGG - Intronic
1183235394 22:36613047-36613069 CACAGAAAAGCCCTGAGGTAAGG - Intronic
1183804103 22:40193639-40193661 CAGAGAAGAGACCTGAGGCATGG + Intronic
1185077297 22:48690254-48690276 CACAGTTACCACCTGGGCCAAGG - Intronic
949808518 3:7980850-7980872 CTCAGTCAATACCTGGGGAAGGG + Intergenic
951220668 3:20065832-20065854 CATAGTGAAGACCTGGGGCTTGG + Intronic
952210158 3:31222303-31222325 CAGAGGACAGACCTGGGTCAGGG - Intergenic
956065832 3:65396163-65396185 CACAGTAGAGATGTGGTGCATGG - Intronic
956776307 3:72568266-72568288 CTCAGTAACCACCTGGGTCACGG - Intergenic
956933264 3:74070580-74070602 CACTGTGCAGACCTGGGGCTTGG - Intergenic
958471367 3:94524726-94524748 CACAGTACATATCTGGGTCACGG - Intergenic
958994793 3:100891919-100891941 CACAGCATAGAGCTGGGGCTGGG + Intronic
959768223 3:110059288-110059310 CACAGTAGAGGCCAGTGGCAAGG - Intergenic
960039491 3:113135319-113135341 TACAGTAAAAACCTGAGGGATGG - Intergenic
961808201 3:129504308-129504330 CAAAGCAAAGGCCTGGGGGAAGG - Exonic
962852196 3:139316513-139316535 CCATGTAAAGACCTGGGGAAAGG + Intronic
965481425 3:169224041-169224063 CATAGAAAAAACCTAGGGCACGG - Intronic
966207859 3:177423308-177423330 TACTGTAAACATCTGGGGCAGGG - Intergenic
966360475 3:179123670-179123692 GACAGCAAACACCTGAGGCATGG + Intergenic
969677198 4:8620689-8620711 CACACTGAGGACCTGGGGCTAGG + Intergenic
969678151 4:8626328-8626350 CACACTGAGGACCTGGGGCTAGG + Intergenic
969679106 4:8631965-8631987 CACACTGAGGACCTGGGGCTAGG + Intergenic
970015652 4:11509782-11509804 CATAGTAAAAGCCTAGGGCATGG + Intergenic
973301328 4:48588397-48588419 CACATTAAAGAACTGGGGGATGG - Intronic
974456000 4:62130163-62130185 AGCAGTACAGACCTGGGGGATGG - Intergenic
977764951 4:100786463-100786485 CACAGTAAGGAGCTGAGCCAGGG + Intronic
980771806 4:137383041-137383063 CAGAGTAAAGACCTATGGAATGG - Intergenic
984024412 4:174525628-174525650 CACAAGAAAGACATGGGGCATGG - Intergenic
984966166 4:185142605-185142627 CACAGGAAAGACCTGGTGCAGGG - Intergenic
986723977 5:10580782-10580804 CACTGAAAAGACCTGGTCCAGGG - Intronic
986770126 5:10965392-10965414 CACAGTTAAGTCATGGAGCAGGG - Intergenic
988793719 5:34633134-34633156 AAAAGTAAACATCTGGGGCATGG + Intergenic
990014296 5:51040067-51040089 GACAATAAAGCTCTGGGGCATGG - Intergenic
990322307 5:54641863-54641885 CTCAGCAAGGAACTGGGGCATGG - Intergenic
992983904 5:82207086-82207108 CACAGTCAAAACCTGGGGCAGGG - Intronic
994173066 5:96679534-96679556 TTCAGTAAAGTCCTGGGGAATGG + Intronic
995089928 5:108162201-108162223 CTCAATAAACACCTGGGGCTGGG + Intronic
995414569 5:111894657-111894679 TACAGTAAAGAGCTGGACCAAGG - Intronic
995490366 5:112684694-112684716 CACAGTAAAGTCTTGAGGCTTGG - Intergenic
997806950 5:136927557-136927579 CACAGTAAAGATGTATGGCAGGG + Intergenic
997893224 5:137693704-137693726 GAGAGCAAAGGCCTGGGGCAAGG - Intronic
998106496 5:139472361-139472383 CAGAGTAAAGACCTGGAGAGAGG - Intergenic
999770890 5:154774687-154774709 GGCAGAAAAGGCCTGGGGCAGGG - Intronic
1000514799 5:162226726-162226748 CCCAGTAAAGAGTTGGGGGATGG + Intergenic
1001857399 5:175024985-175025007 CTCAGGAAAGGCCTGGGACATGG + Intergenic
1001858019 5:175029583-175029605 CCCTGCAAAGACCAGGGGCAAGG + Intergenic
1002272235 5:178080171-178080193 CACAGTAAGTCCCTAGGGCAGGG - Intergenic
1003111099 6:3252860-3252882 CACAGGAAAGACCTTAGGCAAGG + Intronic
1003465744 6:6378236-6378258 AACAGGAAAGACCTGGGCCTTGG + Intergenic
1014084555 6:117328257-117328279 GACAGTGGAGACCTGGAGCAAGG + Intronic
1015863113 6:137701167-137701189 CACATCAAGGACCTGGGACAGGG + Intergenic
1017182415 6:151565522-151565544 AACAGGAAACACCTAGGGCAAGG - Intronic
1019659613 7:2216841-2216863 CACAGGAGAGTCCTGAGGCATGG - Intronic
1020108700 7:5435608-5435630 CACATGCCAGACCTGGGGCAGGG + Intronic
1023057091 7:36299333-36299355 CACAGAGAAGGCGTGGGGCAAGG - Exonic
1023940047 7:44763380-44763402 GACAGTCATGACCTCGGGCAGGG - Exonic
1026921222 7:74157000-74157022 CAGAGTAAAGTCATGGGACAAGG - Intergenic
1027731866 7:81884647-81884669 CTCAGTAAAGACCAGACGCATGG - Intergenic
1032891571 7:136200237-136200259 GACAGAAAACACCTGAGGCACGG - Intergenic
1033629957 7:143147895-143147917 CCCAGTAAAGACCAGGGCCATGG - Intergenic
1034516662 7:151586139-151586161 CTCAGTCAACACCTGGAGCAAGG - Intronic
1035133556 7:156677543-156677565 CACAGTAACTACAAGGGGCAAGG + Intronic
1035649221 8:1252553-1252575 CACAGTCATGTCCTGGGTCATGG + Intergenic
1036807928 8:11847864-11847886 CACGGAGAAGACCTGGGGCAAGG + Intronic
1036970926 8:13354108-13354130 CCAAGCAAAGACATGGGGCAGGG - Intronic
1039248638 8:35636664-35636686 CACAGAAAAGTGCTGGGGGATGG + Intronic
1045569714 8:103356284-103356306 CACAGTAAAGAACATGGGAAGGG + Intergenic
1049028206 8:140012319-140012341 CATAGTAAATAACTGTGGCAGGG - Intronic
1049231076 8:141481885-141481907 GACAGTAAAGGTCTGGGGGAGGG - Intergenic
1049304479 8:141893649-141893671 CACAGACGAGACCTGGAGCATGG - Intergenic
1050596681 9:7211419-7211441 AACAGAAAAGGCCTGAGGCAGGG - Intergenic
1053283994 9:36838862-36838884 CACAGCAAAGACATGTGGCCAGG + Exonic
1053309776 9:37010406-37010428 TAAAGTAAAGTGCTGGGGCATGG - Intronic
1053530152 9:38873132-38873154 TACAGTAAAGACCTGGTGGGGGG + Intergenic
1054202377 9:62097559-62097581 TACAGTAAAGACCTGGTGGGGGG + Intergenic
1054635981 9:67490801-67490823 TACAGTAAAGACCTGGTGGGGGG - Intergenic
1056789761 9:89617875-89617897 CACAGCAGAGCCGTGGGGCAGGG - Intergenic
1057160409 9:92884738-92884760 GAGAGTAAAGGCCTGGGGCAAGG + Intergenic
1057806481 9:98223309-98223331 CCCAGTAAAGACCTGGAGGAAGG + Intronic
1057808054 9:98234903-98234925 CACAGTAAAGATCTGGGATATGG + Intronic
1059579189 9:115525286-115525308 AACAGCAAAGGTCTGGGGCAAGG - Intergenic
1060425167 9:123498625-123498647 CACAGTAAAGATGGGGGCCAGGG + Intronic
1060559343 9:124530035-124530057 CAGAGTGAACACTTGGGGCAAGG - Intronic
1060724520 9:125998132-125998154 CCCAGTCTAGACCTGGTGCATGG - Intergenic
1061242314 9:129381820-129381842 CTCAGTAAAGATCTGTGGGATGG + Intergenic
1062382835 9:136295835-136295857 CAAACCAAAGACCTGGGGGAGGG + Intronic
1062717990 9:138020782-138020804 CCCAGGAAACACCTGGAGCAGGG - Intronic
1186274791 X:7927403-7927425 CCCAGGAAAGTCCTGCGGCAGGG + Exonic
1188418644 X:29969928-29969950 CACAATACAGACCTGGAGCAAGG - Intergenic
1190650394 X:52563377-52563399 CACAGTGGTGACCTGGGGCAGGG - Intergenic
1190744738 X:53315797-53315819 CAGAGTAAAGGCCTGGAGCATGG - Intronic
1191648246 X:63507170-63507192 TAAAGGAAAGACCTGGGGAATGG - Intergenic
1191843760 X:65531309-65531331 CACAGTTAAGCCCAGGGGCCTGG - Intronic
1192246168 X:69373456-69373478 CACAGTGAAGACTTGGGGTTTGG - Intergenic
1194098061 X:89666998-89667020 GACAGTAAACACCTGAGGGATGG - Intergenic
1194125310 X:90009153-90009175 GAGAGTGAAGACCTGGGGAATGG - Intergenic
1194149049 X:90300407-90300429 CACAGTATAGAGCTGCAGCAAGG - Intergenic
1194689364 X:96963691-96963713 TACAGAAAACACCTGAGGCACGG - Intronic
1195792467 X:108603151-108603173 TATAGTAAAGACTTGGGGCTTGG - Intronic
1196236186 X:113283453-113283475 CAGAGTAAACACTTGGGGCTTGG + Intergenic
1197476244 X:126929241-126929263 CACAGTAAAGGCCTGGAGCCTGG - Intergenic
1199672779 X:150160861-150160883 CCCAGAAAACACCTGGGGCCTGG - Intergenic
1200451081 Y:3328386-3328408 GACAGTAAACACCTGAGGGATGG - Intergenic
1200495421 Y:3877139-3877161 CACAGTATAGAGCTGCAGCAGGG - Intergenic
1201273546 Y:12278444-12278466 CACACCAAAAAGCTGGGGCAAGG + Intergenic