ID: 1091254455

View in Genome Browser
Species Human (GRCh38)
Location 11:134171811-134171833
Sequence TGCTGTGTTTGGAGGACAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 333}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091254455_1091254460 2 Left 1091254455 11:134171811-134171833 CCGGCTGTCCTCCAAACACAGCA 0: 1
1: 0
2: 3
3: 29
4: 333
Right 1091254460 11:134171836-134171858 TCTCTCTCAGCCCTCCCAAGGGG 0: 1
1: 0
2: 2
3: 27
4: 271
1091254455_1091254458 0 Left 1091254455 11:134171811-134171833 CCGGCTGTCCTCCAAACACAGCA 0: 1
1: 0
2: 3
3: 29
4: 333
Right 1091254458 11:134171834-134171856 GTTCTCTCTCAGCCCTCCCAAGG 0: 1
1: 0
2: 2
3: 41
4: 296
1091254455_1091254459 1 Left 1091254455 11:134171811-134171833 CCGGCTGTCCTCCAAACACAGCA 0: 1
1: 0
2: 3
3: 29
4: 333
Right 1091254459 11:134171835-134171857 TTCTCTCTCAGCCCTCCCAAGGG 0: 1
1: 0
2: 4
3: 35
4: 329
1091254455_1091254461 5 Left 1091254455 11:134171811-134171833 CCGGCTGTCCTCCAAACACAGCA 0: 1
1: 0
2: 3
3: 29
4: 333
Right 1091254461 11:134171839-134171861 CTCTCAGCCCTCCCAAGGGGAGG 0: 1
1: 0
2: 4
3: 22
4: 260
1091254455_1091254466 28 Left 1091254455 11:134171811-134171833 CCGGCTGTCCTCCAAACACAGCA 0: 1
1: 0
2: 3
3: 29
4: 333
Right 1091254466 11:134171862-134171884 CTGCTTCATCCCTCAGTCAGAGG 0: 1
1: 0
2: 0
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091254455 Original CRISPR TGCTGTGTTTGGAGGACAGC CGG (reversed) Intronic
901810205 1:11763075-11763097 TGGTGTGTGTGGAGGACAGTGGG + Intronic
903171677 1:21558409-21558431 TGGTGTGTTTTGAGGAAGGCAGG + Intronic
904251447 1:29227501-29227523 TGCAATGTTTGGAGGCCAACAGG + Intronic
905016560 1:34782156-34782178 AGCTGGCTTTGGAGGGCAGCTGG + Intronic
905267337 1:36763943-36763965 TGCCGTGGGTGGTGGACAGCGGG + Intergenic
905434178 1:37945815-37945837 TGCTGTGTGAGGGGGACAGCCGG - Exonic
905918282 1:41700832-41700854 GGCTGTGTTTTGAGGCCAGGAGG - Intronic
907129351 1:52081674-52081696 TGCTGTGTTTTTAGAACAGCTGG + Intronic
907730253 1:57059189-57059211 TGCTTTGTTTGGAGGATTGAAGG - Intronic
910685737 1:89914289-89914311 TGCTGTGCTTGCGGGCCAGCTGG - Intronic
911067946 1:93808668-93808690 TTTTGTTTTTGGAGGGCAGCTGG + Intronic
911102376 1:94104819-94104841 GGCTGGGTTTGGAAGACAGCCGG - Intronic
911171537 1:94775483-94775505 TGCTGTGATTGGCTGACATCGGG - Intergenic
912762863 1:112384673-112384695 TACTGTCCTTGGAGGTCAGCTGG - Intergenic
913063058 1:115225571-115225593 TGATGTGTCTGGAGGACTGGAGG + Intergenic
913522572 1:119659735-119659757 TGCTCTGTGTGCAGCACAGCTGG - Intergenic
913563478 1:120047124-120047146 TGCTGTGCTTGAAGGAAAGAGGG - Intronic
913634645 1:120746453-120746475 TGCTGTGCTTGAAGGAAAGAGGG + Intergenic
914284072 1:146206488-146206510 TGCTGTGCTTGAAGGAAAGAGGG - Intronic
914545103 1:148657227-148657249 TGCTGTGCTTGAAGGAAAGAGGG - Intronic
914621463 1:149413461-149413483 TGCTGTGCTTGAAGGAAAGAGGG + Intergenic
915734975 1:158078758-158078780 TGCTGTGTCTGGATGGCTGCTGG + Intronic
916085602 1:161266851-161266873 TGCTGTTTTTGGAGCACCGTTGG - Intronic
917978011 1:180252402-180252424 TGTGGAGTTTGGAAGACAGCTGG + Intronic
920036159 1:203067185-203067207 TGCTGTGTTTGAGGAGCAGCAGG + Intronic
920498472 1:206471582-206471604 GGCTGGGGTTGGAGCACAGCAGG - Intronic
920703295 1:208233856-208233878 TGCTGTGGATGGAGGAAAGCTGG + Intronic
921839762 1:219815819-219815841 TCCTGTGTTTGGAGGGTGGCAGG + Intronic
923207022 1:231768969-231768991 TCCTGTGTTCAGAGGGCAGCTGG + Intronic
1064156211 10:12905442-12905464 GGATGGGTTTGGAGGGCAGCTGG + Intronic
1064511075 10:16092067-16092089 GGCTGAGTTGGGAGGACTGCTGG + Intergenic
1064814815 10:19248091-19248113 TGCTGTGATTGGCAGACAGTCGG + Intronic
1065417322 10:25502504-25502526 TTCAGTGTTTGGAGGACTACTGG - Intronic
1065505874 10:26429635-26429657 AGTTGTATTTAGAGGACAGCTGG + Intergenic
1067074972 10:43172948-43172970 TAGGGTGTTTGGAGCACAGCCGG + Intronic
1070696177 10:78564949-78564971 TGCTGTGTCTGGTAGATAGCAGG - Intergenic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1072323480 10:94273561-94273583 GACTGTGTTTGGAGAAAAGCTGG + Exonic
1072530703 10:96316083-96316105 TGCCGCATTTGAAGGACAGCAGG - Intronic
1074063368 10:109989201-109989223 TGCTGTGTTTGGAGAACATCAGG - Intergenic
1074104097 10:110376053-110376075 TGCAGGGCTGGGAGGACAGCTGG - Intergenic
1075265458 10:120996979-120997001 TGCTGTGTTTGCAGGAACTCTGG - Intergenic
1076041778 10:127256021-127256043 TACAGAGTTTGGAGGACATCTGG + Intronic
1077131465 11:975018-975040 TGCTGTCATTGGAGGACTGCTGG + Intronic
1077487856 11:2847281-2847303 TACTGTGTCTGGAGGAGAACTGG - Intronic
1078272460 11:9808916-9808938 TGGTCTGTTTGGAGGAAGGCTGG - Exonic
1078336411 11:10466657-10466679 CGCTGTGCTGGGAGGACTGCTGG - Intronic
1079110826 11:17604260-17604282 TGCCCTGTTAGGAGGACTGCAGG + Intronic
1081276514 11:41156186-41156208 TGCTGTGATTGCAGGATAGAAGG + Intronic
1081700571 11:45150065-45150087 TGCAGAGTCTGGAGGGCAGCTGG - Intronic
1081748704 11:45491543-45491565 TGGGGTGTTTGCAGAACAGCAGG + Intergenic
1082079595 11:48001978-48002000 AGCTGTGTTTGGAAGTGAGCAGG - Intronic
1084689577 11:70717117-70717139 TGCTGTCTTTGGAGAAAGGCAGG + Intronic
1085361138 11:75888232-75888254 GGCTGTGGTGGGAGGACTGCCGG - Intronic
1086210409 11:84311619-84311641 TTCTCTGTTTGTAAGACAGCTGG - Intronic
1086997335 11:93372939-93372961 AGCTGTGTTTGCATGACTGCGGG + Intronic
1086999285 11:93397321-93397343 TCCTGTGATTGGAGTACAGATGG + Intronic
1087354509 11:97076630-97076652 TGCGGTGCTTGCAGGCCAGCTGG + Intergenic
1088964056 11:114700122-114700144 TGCTGTGTCTGGAATACAGAAGG - Intronic
1089103333 11:115982311-115982333 TGGGAGGTTTGGAGGACAGCAGG - Intergenic
1089584785 11:119503338-119503360 TCCTATGTTTGGGGGTCAGCTGG + Intergenic
1090255993 11:125284813-125284835 AGCTGGGGGTGGAGGACAGCAGG - Intronic
1090416414 11:126543618-126543640 AGCTGTTTTTGGAGCTCAGCTGG - Intronic
1091007118 11:131963284-131963306 GGTTGTGTTTGCATGACAGCTGG + Intronic
1091254455 11:134171811-134171833 TGCTGTGTTTGGAGGACAGCCGG - Intronic
1091619670 12:2076847-2076869 TGCTGTGTGTGAAGGACACTGGG + Intronic
1091671581 12:2456010-2456032 TACTGTGTCTGGAGGTCAGTGGG - Intronic
1091918246 12:4284432-4284454 TGCTTTGGTTGGAGGGGAGCTGG + Intronic
1092083210 12:5735204-5735226 TGTTGTGTTTGGGGAACATCAGG - Intronic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1099045327 12:77710159-77710181 TGTTATGTTTGGAATACAGCTGG - Intergenic
1101474755 12:105034478-105034500 AGTTGTTTTTGGAAGACAGCAGG + Intronic
1101754406 12:107609695-107609717 TCCTGTGATTGCAGGACAGGGGG + Intronic
1102567064 12:113803652-113803674 GGCTGGGGTTGGAGGGCAGCTGG + Intergenic
1102940364 12:116936285-116936307 TGTTGTGTTTGAAGAACAGCAGG + Intronic
1103004995 12:117414009-117414031 TGCTGTGCTTGAAGTACAGGAGG - Intronic
1103243599 12:119435904-119435926 TCATATGTTTGGAGGTCAGCTGG + Intronic
1103446999 12:121001123-121001145 CGCTGTGGTTGGATGGCAGCAGG - Exonic
1103796137 12:123504410-123504432 TGGTGTGTTTCCAGAACAGCAGG + Intronic
1104163543 12:126204270-126204292 TGCTGTGGTTGGCTGACAGCTGG + Intergenic
1106037079 13:26052483-26052505 GGCTGTGTTTGGTGGACTGGAGG + Intergenic
1108455646 13:50611141-50611163 TCCTGTGTTGGAAGGAAAGCAGG + Intronic
1110595262 13:77314359-77314381 TGGTGAGTTTGGAGGACAATTGG - Intronic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1113748438 13:112762230-112762252 CGCTGTGATAGGAGGCCAGCAGG - Intronic
1113882678 13:113636431-113636453 AGCTGTGTGTGGCGGTCAGCGGG + Intronic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1114759679 14:25299407-25299429 TGCCGAGTTTGAAGGACTGCAGG - Intergenic
1115136824 14:30119925-30119947 TCTTGTGTTTGGGGAACAGCTGG - Intronic
1115176247 14:30564431-30564453 AGCTGAGGTGGGAGGACAGCTGG - Intronic
1115359749 14:32488052-32488074 TGCTGTGTTGGGAGATCCGCTGG + Intronic
1116382703 14:44291145-44291167 AGCTGTCTTTGCAAGACAGCAGG + Intergenic
1116635185 14:47385722-47385744 TGCTCTCTTTGGAGGAAAGAAGG + Intronic
1120686378 14:87542678-87542700 TGAAGGGTTTGGAGGAAAGCAGG + Intergenic
1120886879 14:89458681-89458703 TGCAGTGTTGAGAGGGCAGCTGG - Intronic
1121818834 14:96949558-96949580 GCCTGTGTTTGGAGGACCCCAGG + Intergenic
1122058304 14:99119848-99119870 AGCTGGGTTTGGAGAGCAGCAGG + Intergenic
1122428269 14:101624075-101624097 TGGTGGGTTTGGAGCAGAGCAGG - Intergenic
1123044063 14:105502935-105502957 AGGTGGGTTTGGAGGACAGCTGG + Intergenic
1123664943 15:22600707-22600729 TGCAGTGTATGGAGCAGAGCAGG - Intergenic
1124318773 15:28695122-28695144 TGCAGTGTATGGAGCAGAGCAGG - Intergenic
1124362870 15:29051698-29051720 TGCTGTGTTTGGAGCTCTGGGGG + Intronic
1124564673 15:30802317-30802339 TGCAGTGTATGGAGCAGAGCAGG + Intergenic
1124640132 15:31391937-31391959 TGCCGCGTTCGGAGGGCAGCCGG + Intronic
1126091167 15:45053318-45053340 AGCTGTCTTTGGAAGACAGCAGG - Intronic
1126299753 15:47182944-47182966 TGCTATTTTTGGAGGAAAGATGG + Intergenic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1128793144 15:70447853-70447875 AGCTCTGTTTGGAAGAAAGCTGG - Intergenic
1129762632 15:78139483-78139505 TTCTGTGTTTGGAGGATTGTTGG + Intronic
1129880424 15:79003139-79003161 TTGTGTGTTTCGGGGACAGCTGG - Intronic
1130142089 15:81236168-81236190 TGCTGTGGTTGGAGAAAAGGTGG + Intronic
1130161924 15:81410101-81410123 TCAAGTGTTAGGAGGACAGCAGG - Intergenic
1130529852 15:84738529-84738551 TGATGTGTGTGGAGGACAACAGG + Intergenic
1130938551 15:88489691-88489713 GGCTGTGTTTGGAGGCGACCTGG - Intergenic
1131229009 15:90646946-90646968 GGAGGTGTTTGGAGGACACCTGG - Intergenic
1132310566 15:100854468-100854490 GGCTGTGTGTGCAGGAGAGCAGG + Intergenic
1132352105 15:101146237-101146259 GGCTGTGTTAGGAAGAAAGCGGG - Intergenic
1132405166 15:101537416-101537438 TGCTGTGTTTGGGGCACAGGTGG - Intergenic
1132739323 16:1403600-1403622 TGCTGTGTTTGGCTGACTGGGGG - Intronic
1132867453 16:2100520-2100542 TGCTGTATGGGGTGGACAGCCGG - Exonic
1134524325 16:14932595-14932617 TGCTGTATGGGGTGGACAGCCGG + Intronic
1134548578 16:15128343-15128365 TGCTGTATGGGGTGGACAGCCGG - Intronic
1134711914 16:16331082-16331104 TGCTGTATGGGGTGGACAGCCGG + Intergenic
1134719770 16:16374375-16374397 TGCTGTATGGGGTGGACAGCCGG + Intergenic
1134947656 16:18337510-18337532 TGCTGTATGGGGTGGACAGCCGG - Intergenic
1134954914 16:18377612-18377634 TGCTGTATGGGGTGGACAGCCGG - Intergenic
1135527844 16:23227677-23227699 TGCTGTGATTGGTTGAAAGCTGG - Intergenic
1136120047 16:28127003-28127025 AGCTGATTTTGGAGCACAGCGGG - Intronic
1137272011 16:46908164-46908186 TCCTGTGTTTGGGGGACTGGTGG + Intronic
1137272045 16:46908284-46908306 TCCTGTGTTTGGGGGACTGGTGG + Intronic
1137411792 16:48234829-48234851 TGCTGTCTTTGCAAGCCAGCTGG - Intronic
1140077650 16:71716654-71716676 TGGTGTGTTTGGAGAGCTGCAGG - Intronic
1140428894 16:74884734-74884756 TGGTGTGGTTGGAGTACAGTGGG - Intronic
1141234340 16:82201419-82201441 TGATGTGTGAGGAGGTCAGCTGG + Intergenic
1141441300 16:84031378-84031400 GGCAGTGTTTTGAGTACAGCAGG - Intronic
1141838215 16:86556751-86556773 GGCTCTGTTTTGAGCACAGCTGG - Intergenic
1141968247 16:87461756-87461778 TGCTGTCTGTGGAATACAGCAGG - Intronic
1142362392 16:89633598-89633620 TGCTTTCCTTGGAGGGCAGCTGG - Intronic
1142597638 17:1037252-1037274 TGGGGAGTTGGGAGGACAGCAGG - Intronic
1143001539 17:3798137-3798159 TGCAGTGTGTGGGGGAGAGCTGG - Intronic
1143088704 17:4435641-4435663 GGCTGTGTTTCTAGGACAACAGG + Intronic
1143352998 17:6302959-6302981 GGCTGTGTTTGGATAATAGCAGG - Intergenic
1143681724 17:8480793-8480815 TGTTGTCTGTGGAGAACAGCTGG - Intronic
1143786573 17:9260220-9260242 GGCTGTGGTGGGAGGACTGCTGG + Intronic
1144955274 17:19015875-19015897 GGCTGTGTCTGGAGAACAGGTGG + Intronic
1145099729 17:20064541-20064563 TGCTGGGGTGGGAGGACAGCAGG + Intronic
1145264098 17:21371268-21371290 TGCTGGGTCTGCAGGAAAGCAGG - Intergenic
1146818815 17:35968039-35968061 TCCTGTATGTGGAGGAAAGCCGG + Intergenic
1148016835 17:44527995-44528017 TGCCGTGCTTGCAGGCCAGCTGG + Intergenic
1148207600 17:45789106-45789128 TGCCGTGTCTGGAGGAGGGCAGG + Intronic
1148366211 17:47057613-47057635 TGCGGTGCTTGCAGGCCAGCTGG - Intergenic
1148616270 17:49002758-49002780 TGCACTGTTTGGAGGAAAGGTGG + Intronic
1148695530 17:49555997-49556019 TGCTGGGGTTAGAGGACGGCGGG + Intergenic
1149551980 17:57547163-57547185 TGATGTGTTGGTAGGACAGGTGG + Intronic
1150076131 17:62193632-62193654 TAGTGGGCTTGGAGGACAGCAGG - Intergenic
1150584898 17:66508589-66508611 TCCTGTGTGCAGAGGACAGCTGG - Intronic
1151969237 17:77449430-77449452 GGCTGGGCTTGGAGGAGAGCAGG + Intronic
1151999968 17:77639091-77639113 TGCTGTGTTTTGAAGAGGGCTGG - Intergenic
1152751386 17:82064034-82064056 TGGTGAGCTTGGAGGACGGCAGG - Intronic
1153037228 18:774938-774960 TGGTCTGTTTGAAGGAGAGCAGG - Intronic
1153955236 18:10090461-10090483 TGCTGTTTTAGGAAGACAGTCGG + Intergenic
1157590988 18:48836384-48836406 TGCTCTGCCTGGAGGACAGTGGG + Intronic
1158157024 18:54437450-54437472 TGTTTTGTTTGGAGCAGAGCAGG - Intergenic
1159558466 18:69969128-69969150 TGCTCTGGTTTGAGGACTGCTGG + Intergenic
1159592515 18:70350797-70350819 TGCTAGGTTTGGAGGACTTCTGG + Intronic
1163086094 19:14980355-14980377 TGCTGTCTTTAGAGCACACCAGG + Intronic
1163179090 19:15585887-15585909 AGCAGTCTTTGGAGGACTGCTGG + Intergenic
1163205844 19:15802164-15802186 TGGTGTGTTTGAGGGACAGTGGG + Intergenic
1163536872 19:17881939-17881961 TGCTGTGTGAGGAAGGCAGCGGG - Exonic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1167710472 19:51107491-51107513 TGCTGTGTGGGGAGGACTGTTGG + Intronic
1168284240 19:55322502-55322524 TGCTTGGAGTGGAGGACAGCTGG - Intronic
925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG + Intronic
925538256 2:4939215-4939237 ATCTCAGTTTGGAGGACAGCTGG + Intergenic
926012200 2:9417236-9417258 CTGTGTGTTTGGGGGACAGCAGG - Intronic
926033602 2:9615476-9615498 TCATGTGGTTGGAGGACAGAGGG + Intronic
926758154 2:16252414-16252436 TGCTGTGGTTGGAGGCCCCCGGG + Intergenic
927085200 2:19668397-19668419 GGATGTGTTTGCAGGACAGGAGG + Intergenic
928392849 2:30922505-30922527 TGCTGCCTTTGCAGGACAGTGGG - Intronic
930586086 2:53268384-53268406 TGCAGTGTTTGGAAGAAAGAGGG - Intergenic
931366854 2:61626733-61626755 TTCTGGGTGTGGGGGACAGCAGG - Intergenic
932748938 2:74358590-74358612 TGCTGGGTCTGGAGCTCAGCAGG - Intronic
933184987 2:79268683-79268705 AACTGTGTTGGGAGGACACCTGG + Intronic
934108115 2:88714943-88714965 TGCTGTTTTGGGAGTACAGAGGG + Intronic
935559688 2:104547433-104547455 TCCTGTGTTGGGAGCACAGCGGG - Intergenic
937395139 2:121528643-121528665 AGATGTGTTTTGAGGTCAGCTGG - Intronic
938227287 2:129626921-129626943 TGATGTGCTTGGAGCCCAGCAGG + Intergenic
939818066 2:146921092-146921114 TGCCATGTTTGGAGCCCAGCTGG - Intergenic
940834137 2:158501533-158501555 TGCTGTGGATGGATGTCAGCAGG - Intronic
942066469 2:172276564-172276586 AGCTGTGTTTGGAGTTCAGGAGG + Intergenic
943392923 2:187292972-187292994 TGTTGTGTGGGGAAGACAGCTGG + Intergenic
943717724 2:191170658-191170680 TGCTGTGTATGGTGGAAAGTAGG + Intergenic
944054629 2:195510537-195510559 TGCTTTGTTAGGGTGACAGCAGG - Intergenic
944422068 2:199542051-199542073 TGGTGTGTTTGGGGAACAACAGG - Intergenic
944805394 2:203276172-203276194 TGCTGTATTTGAAGTACAACAGG + Intronic
945745748 2:213718521-213718543 TGCGGTGCTTGCAGGCCAGCTGG + Intronic
946168632 2:217880497-217880519 TGCTGTTTTTGCAGCACAGTGGG + Intronic
947069304 2:226268977-226268999 TGCTGCTTTTGCAGAACAGCAGG + Intergenic
947078911 2:226373849-226373871 CACTGTGGTTGGAGCACAGCAGG - Intergenic
948714758 2:239853855-239853877 TGCTGTGTTAGGCTCACAGCTGG + Intergenic
948863016 2:240762021-240762043 TGCTGTGTTGGGAGGAGGGGTGG - Intronic
1169040691 20:2492873-2492895 CCCTGTGTGTGGAGCACAGCTGG + Intronic
1169111780 20:3038795-3038817 GGCTGTGTTTGGTGGACAGGAGG - Intronic
1170313297 20:15016255-15016277 TGTTATGGGTGGAGGACAGCAGG + Intronic
1170360768 20:15543756-15543778 AGCTGTGTCTGGAAGTCAGCTGG + Intronic
1170574074 20:17649541-17649563 CGCTGGGTTTGGAGCAAAGCAGG + Intronic
1171447396 20:25214431-25214453 GGCAGTGTTTGGAGCCCAGCAGG + Intronic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1172177402 20:32980645-32980667 TGCTGACCTTGGAGGACAGGAGG + Intergenic
1172181790 20:33008103-33008125 GGCTGAATTTGGTGGACAGCTGG + Intronic
1172354183 20:34268313-34268335 TGCTGCGTTCGGTGCACAGCGGG + Intronic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1174595119 20:51677734-51677756 TACTGTGTCTGGAGGATAGAAGG - Intronic
1175203651 20:57294636-57294658 TGCTGTCTTTGGAGGAGGGTGGG + Intergenic
1176302438 21:5104960-5104982 TGCTGTGTTGAGAGGGCATCTGG + Intergenic
1178459648 21:32791077-32791099 TGCAGGGTTTGGGGGACAACAGG - Exonic
1178851977 21:36220009-36220031 AGTGGTGTTTGGAAGACAGCGGG + Intronic
1178930451 21:36814135-36814157 TAGTGTGTTTGGGGGAGAGCAGG - Intronic
1179007894 21:37530922-37530944 TGCAGTGTTATGAGGAGAGCCGG + Intergenic
1179552223 21:42150639-42150661 CGCTGTGTTTGGGGGACTGGCGG - Intergenic
1179854589 21:44156963-44156985 TGCTGTGTTGAGAGGGCATCTGG - Intergenic
1179984028 21:44911425-44911447 GCCTGTGCTTGGAGGAGAGCTGG + Intronic
1181636642 22:24177766-24177788 TGCTGCCTTTGGGGGAGAGCAGG - Exonic
1181804842 22:25368500-25368522 TGTTCTGGTTGGAGGACAGGCGG - Intronic
1182747926 22:32619943-32619965 TCCTGTGTTTGGAGGTCAGCTGG - Intronic
1183700525 22:39448512-39448534 TGCTGGGTGTGGAGGAGAGGAGG + Intergenic
1184407098 22:44306453-44306475 TGGTGTGTGTGGAGGAGACCTGG + Intronic
949594800 3:5532328-5532350 CGCTGTGGTTGGTAGACAGCAGG + Intergenic
950716147 3:14849011-14849033 TTCTGTGTTTGGAGTAGAGGAGG + Intronic
951221364 3:20071962-20071984 AGCTGTGTTTGTGGGACATCAGG + Intronic
951274030 3:20663342-20663364 TGCTGTCATTGGAGAACAGACGG + Intergenic
952458034 3:33492756-33492778 TGCTGAGGTGGGAGGACTGCCGG + Intergenic
952752808 3:36839139-36839161 TGCAGTGTTGGCAGAACAGCTGG + Intronic
952958643 3:38576238-38576260 TGGTATATTTGGAGGATAGCTGG - Intronic
953044242 3:39281053-39281075 TGTGGTGTTCCGAGGACAGCGGG + Intronic
953353038 3:42230311-42230333 TGCTGTGGTTGGCGGAGGGCGGG + Intergenic
953466732 3:43128332-43128354 TGATGTCTTTGGACGACAGCTGG - Intergenic
954034976 3:47846557-47846579 TGCTGTGTCTGTGGCACAGCGGG + Exonic
954988957 3:54821929-54821951 TGCTGTTTTTGTAGAACTGCAGG + Intronic
955093641 3:55775849-55775871 TGCTTTGTTTGGTGTGCAGCAGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958967678 3:100577089-100577111 TCTTTTGTTTGGAGAACAGCTGG + Exonic
959474273 3:106790440-106790462 TGCTGTGTCGGGATGAGAGCCGG + Intergenic
960761137 3:121074865-121074887 ATGTGTGATTGGAGGACAGCAGG - Intronic
961039014 3:123663907-123663929 TGCTGAGCCTGGAGGTCAGCAGG + Intronic
962267671 3:133955244-133955266 GGCCGGGTTTGGAGGCCAGCCGG - Intronic
962283782 3:134070589-134070611 TGCGGTGCTTGCAGGCCAGCTGG - Intronic
963907279 3:150783055-150783077 TGCTGGGGTTGAAGGACAGGAGG + Intergenic
964703601 3:159595222-159595244 TCCTCTGTTTTGAGGACAGTTGG - Intronic
965516784 3:169630108-169630130 TGCTGTGTGTTGAGGAGAGAAGG - Intronic
967890115 3:194358983-194359005 GGCTGTTCTTGGAGGACAGGTGG + Exonic
968869473 4:3234355-3234377 TGCTGTGCTAGCAGGACAGGCGG + Intronic
971811923 4:31438682-31438704 TGCGGTGCTTGCCGGACAGCTGG + Intergenic
972384700 4:38553792-38553814 CTCTGTGTTTGGGGGACACCAGG - Intergenic
972430286 4:38975216-38975238 GGATGTGTGTGGAGGAGAGCAGG - Intronic
973342466 4:49019398-49019420 TGGTGTGTTTGAGGGACATCAGG + Intronic
974390787 4:61264644-61264666 TACTGTGCTTGGAAGACAGTAGG + Intronic
974860780 4:67518833-67518855 TGCTATGCTTTGTGGACAGCTGG - Intronic
977257268 4:94755027-94755049 TGGCGTGTTTAGAGAACAGCTGG - Intergenic
978366973 4:107992537-107992559 TGATGTGTTTTGAGTACAGATGG + Intronic
978998365 4:115184295-115184317 TGCTGTGATTCCAGAACAGCAGG + Intergenic
980582366 4:134771702-134771724 TGGTGTGTGTGGAAGACAGAGGG - Intergenic
981443208 4:144806627-144806649 TGGTGTGTGTGGATGACTGCTGG - Intergenic
981730278 4:147889709-147889731 TCCTGTGTTGGGAGGGCAGCTGG + Intronic
982402912 4:154988163-154988185 TGATGTCCTTGGAGGACAACGGG + Intergenic
983287466 4:165757861-165757883 TGCTGTGCTGTGAGGACAGCAGG - Intergenic
984624412 4:181989329-181989351 AGCTGTGTTTAAAGGAGAGCTGG + Intergenic
985274356 4:188223462-188223484 TGCTGCCCTTGAAGGACAGCTGG - Intergenic
986742352 5:10715163-10715185 TCCTGTTTTTGGAGGAGAGGAGG + Intronic
988561637 5:32286906-32286928 TGCTGTGCGTGGAAGAGAGCAGG - Intronic
989473226 5:41845154-41845176 TGCCGTGTTTGGGGAACAGGAGG - Intronic
990851317 5:60208352-60208374 TGGTGTGTCTGAAGCACAGCTGG + Intronic
991636324 5:68709626-68709648 TGCTAGGTTTGGAGGACAGCTGG - Intergenic
995461890 5:112411966-112411988 TGCTTTGTTTAGAGAACAGTGGG - Intronic
997269991 5:132528315-132528337 TGGTGTGGTTGAAGAACAGCAGG - Intergenic
997524835 5:134545621-134545643 TGCTGTGGTTAAAGGACAGTGGG + Intronic
998348759 5:141487076-141487098 TTCTGTGGTGGGAGGTCAGCTGG - Exonic
998615018 5:143730524-143730546 TGCTGTGTTTGGAAGTTATCAGG - Intergenic
1001288652 5:170441156-170441178 TGCTGGGCTGGGAGGGCAGCTGG - Intronic
1001570038 5:172724890-172724912 TCCTGTGTTGTGGGGACAGCTGG + Intergenic
1002462009 5:179378582-179378604 TTCTGTGCTTGGAGAACAGGAGG - Intergenic
1004311434 6:14549380-14549402 TGGTGGCTCTGGAGGACAGCAGG - Intergenic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1006151802 6:31993859-31993881 TGCTGTGTCTCGGGGCCAGCCGG + Intronic
1006158103 6:32026597-32026619 TGCTGTGTCTCGGGGCCAGCCGG + Intronic
1007105098 6:39278336-39278358 TACTGAGTTTCGAGGCCAGCAGG - Intergenic
1012168345 6:95987689-95987711 TTATCTGTTTGGTGGACAGCTGG - Intergenic
1012999254 6:106006126-106006148 TGCTGTATTCTGGGGACAGCAGG + Intergenic
1013027197 6:106287385-106287407 TGCTGTGCTTGAAAGACAGTTGG + Intronic
1013178494 6:107698395-107698417 TGCTGTGGGTGGGTGACAGCTGG + Intergenic
1013532414 6:111032275-111032297 GGCTGAGTTTGGAGGACTGCTGG - Intergenic
1014473166 6:121840661-121840683 TGCTGTGTTTTCAGAACAGAGGG + Intergenic
1014860309 6:126458378-126458400 TGCTGTGGTTTGAGGAGAGAGGG - Intergenic
1015351351 6:132224047-132224069 TGGTGTGTTTGAGGAACAGCAGG + Intergenic
1015534109 6:134249626-134249648 GGCTGTGTTTCCAGGACAGGGGG - Intronic
1015721747 6:136249937-136249959 CGCTGTGTTTGGAGAGCACCAGG - Intronic
1017043307 6:150324896-150324918 TCCTGTGCTGGGAGGACAGCTGG + Intergenic
1017093966 6:150787702-150787724 TGTTGTGTTTGGAAGCCATCAGG - Intronic
1018810066 6:167292862-167292884 TGCTGTGCCAGGAGGACAGCAGG - Intronic
1018910284 6:168097664-168097686 TGCTGTGTCTGCAGCCCAGCAGG - Intergenic
1020678032 7:11203355-11203377 GGCTGAGGCTGGAGGACAGCTGG + Intergenic
1020863922 7:13531947-13531969 TGCAGTGCTTGGAAGACAGTAGG - Intergenic
1021264389 7:18501696-18501718 TGCTGTGTTTGGTGAAGAGGAGG + Intronic
1021325766 7:19265697-19265719 TGATGTGTTTGGGTGACAGATGG + Intergenic
1023044790 7:36201604-36201626 TGCTGTGTTTGGTTCACAGTAGG + Intronic
1023307447 7:38845764-38845786 TGCAGTGTTTGGTGTATAGCAGG - Intronic
1024324615 7:48099432-48099454 GGCTCTGTTTGGAGGGCAACAGG - Intronic
1024685849 7:51744467-51744489 TTTGGTCTTTGGAGGACAGCAGG + Intergenic
1024879070 7:54065045-54065067 GGATGTGTTCAGAGGACAGCTGG - Intergenic
1025606896 7:63045934-63045956 TGCAGTGTTTTGTGCACAGCAGG - Intergenic
1027486141 7:78764039-78764061 TGCTGTGGTTTAAGGACAACTGG + Intronic
1029311563 7:99671796-99671818 TGTTGTGACTGTAGGACAGCAGG + Intronic
1031140694 7:117939793-117939815 AGCTGCTTTGGGAGGACAGCAGG - Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032446334 7:131986938-131986960 TGGTGTGGCTGGAGTACAGCGGG + Intergenic
1032985142 7:137329418-137329440 TGCTGTGTTTTGAGGACCCATGG - Intronic
1033432482 7:141301743-141301765 TGCTGGATTTGGAGGACATCTGG - Intronic
1033708169 7:143908604-143908626 TCCTCTGTTTGGAAAACAGCCGG + Intergenic
1034193085 7:149225794-149225816 TGCAGGGTGTGGAGCACAGCAGG - Exonic
1034316945 7:150141996-150142018 GGCTGGGGCTGGAGGACAGCAGG - Intergenic
1034789919 7:153958690-153958712 GGCTGGGGCTGGAGGACAGCAGG + Intronic
1035399506 7:158555593-158555615 GGCTGGGTCTGGGGGACAGCTGG - Intronic
1035438602 7:158878214-158878236 TGCTGTGTGGGGAGGCCAGGAGG + Intronic
1037857603 8:22383071-22383093 TGCTGGCTTTGGTGGAAAGCTGG + Intronic
1038084199 8:24175302-24175324 AGCTCTGTTTGGGGGACAGTGGG - Intergenic
1039260589 8:35766988-35767010 TGCAGATTTTGCAGGACAGCTGG - Exonic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1041716171 8:60934361-60934383 TGCTGTGTTTCAGGCACAGCTGG + Intergenic
1042515905 8:69658852-69658874 TGCAGGGTTTGAAGGTCAGCTGG - Exonic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1044105163 8:88195662-88195684 TGCAGTGATTAGAGGGCAGCAGG + Intronic
1044739172 8:95308127-95308149 TGCTGTGTCTGGAGGAGATTTGG + Intergenic
1047438266 8:124853817-124853839 TGATGTGTCTGAAGGACAGCAGG + Intergenic
1048716728 8:137279346-137279368 TGCTGTCTTTGGCGGACAAAAGG - Intergenic
1049124244 8:140772326-140772348 GGCTGAGTTGGGAGGACTGCTGG + Intronic
1049271641 8:141699205-141699227 TTCTGTGGTTGGTGAACAGCAGG - Intergenic
1050372972 9:4941331-4941353 TGCTTCTTTTGCAGGACAGCTGG + Intergenic
1055028715 9:71750321-71750343 TTCTGAGGTTGGAGGAAAGCAGG + Exonic
1059749252 9:117232429-117232451 GGCTGCTTTTGGAGGGCAGCTGG - Intronic
1059810585 9:117852057-117852079 TGCCGTGCTTGCGGGACAGCTGG + Intergenic
1060794178 9:126503533-126503555 TGAGGTTTTTGGAGGACAACTGG - Exonic
1061026390 9:128052476-128052498 TGTTGTCTTTGTAGGACAGCTGG + Intergenic
1061869530 9:133513381-133513403 TGCTGTCTGTGAAGGACTGCGGG - Intergenic
1061963549 9:134000210-134000232 TGCTGTGGCTAGAGGACAGCTGG - Intergenic
1062635556 9:137488756-137488778 TGCTGTGGGTGGTGGACAGTTGG - Intronic
1185473704 X:400480-400502 CGCTATTTTTGGAGGGCAGCTGG + Intergenic
1186095505 X:6097454-6097476 TGCTGTGGTTGCAGGAGGGCAGG + Intronic
1186245558 X:7612949-7612971 GGCTGTGTTTGGCACACAGCAGG + Intergenic
1187222170 X:17338693-17338715 AGCTGTGTGTGGAGCACAGGGGG + Intergenic
1187979897 X:24745134-24745156 TGGTGTGCTTTGGGGACAGCTGG + Intronic
1190362458 X:49662130-49662152 GGCTGTGCTTGCAGGACTGCAGG + Intergenic
1191757761 X:64612729-64612751 AGCTGTCTTTGCAAGACAGCAGG + Intergenic
1192109799 X:68352377-68352399 TGATGTGTTTTGAGGAGGGCTGG - Intronic
1192604040 X:72495111-72495133 TGCTTTGCTGCGAGGACAGCAGG - Intronic
1195741857 X:108072871-108072893 GTCTGTGGTTGGATGACAGCAGG + Intronic
1196073704 X:111551639-111551661 TGATGTGTTGGAAGAACAGCAGG - Intergenic
1196441673 X:115724730-115724752 GGATGTGTTTGGAGGATTGCTGG - Intergenic
1196445203 X:115842719-115842741 GGATGTGTTTGGAGGATTGCTGG - Intergenic
1197128864 X:122980402-122980424 GGCTGTGTATGGAGGAAAGGAGG - Intergenic
1197155070 X:123261706-123261728 TGCATTGTTTGCAAGACAGCTGG + Intronic
1197234870 X:124049875-124049897 TGGTGTGTTCAGAAGACAGCAGG - Intronic
1199033098 X:143024028-143024050 GGTTGTGTTTGGAGGTCAGCAGG + Intergenic
1200392195 X:155955896-155955918 TGCTGTGGCTACAGGACAGCTGG + Intergenic
1201496968 Y:14598527-14598549 TGCTGTGCTTGCAGGCCAGCTGG - Intronic
1201503073 Y:14666905-14666927 TGCTGTGGTTGCAGGAGGGCAGG - Intronic