ID: 1091255051

View in Genome Browser
Species Human (GRCh38)
Location 11:134176383-134176405
Sequence CCTCCTGTGCAGAGAGAAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 385}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091255047_1091255051 -4 Left 1091255047 11:134176364-134176386 CCCTTCCATTTCACAAATTCCTC 0: 1
1: 0
2: 0
3: 38
4: 370
Right 1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG 0: 1
1: 1
2: 2
3: 45
4: 385
1091255049_1091255051 -9 Left 1091255049 11:134176369-134176391 CCATTTCACAAATTCCTCCTGTG 0: 1
1: 0
2: 3
3: 23
4: 311
Right 1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG 0: 1
1: 1
2: 2
3: 45
4: 385
1091255048_1091255051 -5 Left 1091255048 11:134176365-134176387 CCTTCCATTTCACAAATTCCTCC 0: 1
1: 0
2: 2
3: 28
4: 322
Right 1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG 0: 1
1: 1
2: 2
3: 45
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091255051 Original CRISPR CCTCCTGTGCAGAGAGAAGC CGG Exonic
900546735 1:3233595-3233617 CCTGCTGGGCAGAGAGGACCAGG - Intronic
901209059 1:7514342-7514364 GCTCCTGAGCAGAGAGACTCTGG - Intronic
901768778 1:11520020-11520042 TTTCCTGTGCAGAATGAAGCCGG + Intronic
902517479 1:16997105-16997127 CCTACTGTGCAGAGACACACCGG - Exonic
902659244 1:17889976-17889998 CCTTCTGGGCAGAAAGAAGTGGG + Intergenic
902779901 1:18698452-18698474 CCTCCTGGGCATGGAGAAGGGGG - Intronic
903682064 1:25103703-25103725 CCCCGTGAGCAGAGAGCAGCTGG - Intergenic
904323556 1:29712231-29712253 CATCCTCTGCACAGACAAGCTGG - Intergenic
904501438 1:30915069-30915091 CCACCTCTGCACAGAGAAGAGGG - Intergenic
904601751 1:31676838-31676860 AATCCTGTGCAGGGAGGAGCAGG - Intronic
904684394 1:32250109-32250131 CCTCAGCTGCAGAGAGAAGTGGG - Intergenic
905028170 1:34865407-34865429 CCTCTTCTGGAGAGAGCAGCTGG + Intergenic
905811294 1:40915357-40915379 CTTCCTGGGCAGAGTGATGCAGG + Intergenic
906070941 1:43015954-43015976 CCTCCTGTATAGTGAGTAGCTGG - Intergenic
906448288 1:45922327-45922349 GCTCCTGGGTGGAGAGAAGCTGG - Intronic
906977998 1:50596085-50596107 CCTTCTGTTCAAAGAAAAGCTGG + Intronic
907871063 1:58443275-58443297 CCTCCTGTACTGTGAGAGGCTGG - Intronic
907985312 1:59524362-59524384 GCTCCTGGGCAGAAAGGAGCGGG + Intronic
908499610 1:64730064-64730086 CCTTGTGTCCAGAGACAAGCAGG - Intergenic
913333069 1:117683324-117683346 ACCACTGTGCACAGAGAAGCTGG + Intergenic
915209070 1:154293151-154293173 CCTCCTGAGTAGTGAGTAGCTGG - Intergenic
915595681 1:156895143-156895165 CCTCCAGTGGAGAGAGAGGAAGG - Intronic
918046200 1:180942402-180942424 TCTCCTAGGCAGAGTGAAGCAGG + Intronic
918636662 1:186782875-186782897 CCTTCTCTGCAGTGAGAGGCAGG + Intergenic
919350136 1:196440996-196441018 CATCCTGCTCAGAAAGAAGCTGG + Intronic
920195567 1:204223907-204223929 ACTACTGTGCAGACAGAACCAGG + Intronic
922175030 1:223190058-223190080 CGTCCTGGGCAGAGAGAGGTGGG - Intergenic
922449274 1:225723701-225723723 CTTTCTGTGCAGCGAGAAGCAGG + Intergenic
922606620 1:226893768-226893790 CAACCTGGGCAGAGAAAAGCGGG - Intronic
922718971 1:227890701-227890723 CCTCCAGGGCAGAAAGAAGAGGG + Intergenic
922776712 1:228217661-228217683 TCTCATGTGCAGGGAGAAGAAGG + Intronic
922975899 1:229783074-229783096 CCTCCTCCTCAGAGAGGAGCAGG + Intergenic
923171990 1:231425629-231425651 CCCCCAGTACAGAGACAAGCAGG - Intergenic
923538230 1:234869504-234869526 CATCATCTGCAGAGATAAGCAGG - Intergenic
1062956865 10:1546288-1546310 CTTTCCGTGCAGAGAGCAGCAGG + Intronic
1063759163 10:9052732-9052754 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1064265296 10:13820917-13820939 CCTCCTGTCCAGAGAGATGGGGG - Intronic
1064774215 10:18757444-18757466 CCTCCTGAGTAGTGAGTAGCTGG + Intergenic
1065835782 10:29656829-29656851 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
1066279253 10:33899032-33899054 CTTCCTGTGCAGCCAGCAGCAGG + Intergenic
1067239290 10:44476649-44476671 GCTCCTCTGCAGAGGCAAGCTGG - Intergenic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1068370595 10:56109268-56109290 CCTCCTGAGTAGTGAGCAGCTGG + Intergenic
1068630374 10:59291443-59291465 GCTCCTGAACAGAGGGAAGCTGG - Intronic
1068700641 10:60016003-60016025 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1069616031 10:69806607-69806629 CTTGCTGTGAAGAAAGAAGCTGG + Intronic
1071056221 10:81510840-81510862 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1071073525 10:81724781-81724803 CTTTCTGTGCAGAGAGCTGCAGG + Intergenic
1072072805 10:91936332-91936354 CCTGATGTGCAGAGTAAAGCAGG + Intronic
1072278987 10:93848935-93848957 CATTCTGTGCAGTGAGCAGCAGG + Intergenic
1073106860 10:101037064-101037086 CCTCCCTTGCAGAGAGCTGCAGG + Exonic
1074266538 10:111909908-111909930 CCTCCTCTTCAGTCAGAAGCTGG - Intergenic
1074536850 10:114334228-114334250 CTGCCTGGGCAGAGAAAAGCTGG + Intronic
1074563777 10:114558106-114558128 CTTTCTGTGCAGCGAGCAGCGGG + Intronic
1075009711 10:118857263-118857285 TCTCCTGTGCTGAGAGATGGGGG + Intergenic
1075307892 10:121384078-121384100 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1075740295 10:124691842-124691864 CATCCTGTGTGGGGAGAAGCGGG - Intronic
1076141286 10:128080394-128080416 CGCCCTGTGCATAGAGAGGCAGG + Intronic
1076287907 10:129319070-129319092 CTTTCTGTGCTGAGAGCAGCAGG - Intergenic
1076389858 10:130091019-130091041 CCAGCTCTGAAGAGAGAAGCGGG + Intergenic
1076692371 10:132230406-132230428 GCGCCTGTGCAGAGTGAGGCTGG - Intronic
1077126857 11:943583-943605 CCTACTTTCCACAGAGAAGCTGG - Intronic
1077252673 11:1567500-1567522 GCTCCTGGGCAGGGAGGAGCTGG - Intronic
1077269602 11:1669328-1669350 CTTTCTGTGCAGAGAGCAGGGGG + Intergenic
1082239588 11:49856156-49856178 CCTCCTGAGCAAAGAGGAGGGGG - Intergenic
1082242566 11:49888195-49888217 CCTCCTGAGCAAAGAGGAGGGGG + Intergenic
1082657053 11:55868998-55869020 CCTTCTGAGCAAAGAGAAGGGGG + Intergenic
1082767438 11:57180645-57180667 TCGCCTGTGCAGAAGGAAGCTGG + Intergenic
1082822646 11:57554620-57554642 GGTCCTGTGCAGAGAGAAAAGGG + Exonic
1082831570 11:57622361-57622383 CCTCTTGGGCACAGAGGAGCAGG + Intergenic
1083318045 11:61828323-61828345 CCGTCTGTGCAGCGAGCAGCCGG + Exonic
1083650902 11:64204155-64204177 CCTCATGTGGAAAGAGGAGCTGG + Exonic
1083777583 11:64901845-64901867 GCTCCCGTGGTGAGAGAAGCAGG - Intronic
1084185299 11:67468148-67468170 CCTCCCGGGAAGAGAAAAGCAGG + Intronic
1084724089 11:70929003-70929025 TGTCTTGTGGAGAGAGAAGCTGG + Intronic
1086249294 11:84794969-84794991 GCTCCTGGGCAGAAAGGAGCAGG + Intronic
1088923080 11:114275954-114275976 CCTTCTTTCCAGAGAGAAGTGGG + Intronic
1090481431 11:127072067-127072089 TCTCCTGGGGAGAGAGAAGCAGG - Intergenic
1090662059 11:128889968-128889990 CCCCCTCTACAGAGAGAAGAGGG + Intergenic
1090819507 11:130328559-130328581 CCTCCTGAGTAGATGGAAGCTGG - Intergenic
1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG + Exonic
1092126297 12:6077325-6077347 CCTAAGGTGCAGAGAGAACCCGG - Intronic
1093630871 12:21407684-21407706 CCTCCTGAGTAGGGAGTAGCTGG - Intronic
1093693236 12:22130981-22131003 GCTCCAGTGGAGAGAGGAGCTGG - Intronic
1095372063 12:41480167-41480189 CCACCTGTTGAGAGAGCAGCTGG + Intronic
1096586330 12:52622693-52622715 CCTCGTGTGGAAAGAGGAGCTGG - Intergenic
1098437470 12:70483240-70483262 CATTCTGTGCAGTGAGCAGCAGG - Intergenic
1099517486 12:83615394-83615416 CTTTCTGTACAGAGAGCAGCAGG + Intergenic
1100172083 12:91986558-91986580 CCACCATTGCAGAGAGCAGCAGG + Exonic
1100890263 12:99117775-99117797 CCAGATGTGCAAAGAGAAGCTGG - Intronic
1101031855 12:100668372-100668394 CCTCCTGAGTAGCGAGTAGCTGG - Intergenic
1101128254 12:101661772-101661794 CCTCCTGAGTAGCGAGTAGCTGG - Intronic
1102949909 12:117024472-117024494 CCTCCTCTGCAGAGCGGTGCTGG - Intronic
1105468353 13:20668611-20668633 CCTCCTGTGCACAGAGAATGTGG - Intronic
1105882143 13:24614532-24614554 CCTCCTGGACAGAGAGAGGCAGG + Intergenic
1106176479 13:27336589-27336611 CCTCCTGTGGGGACAGCAGCCGG - Intergenic
1106838344 13:33660107-33660129 CCTCGTGAGCAGAGCGTAGCTGG - Intergenic
1106842244 13:33696296-33696318 CCTGCTGTGCAGAGATGAGGTGG - Intergenic
1107058536 13:36131352-36131374 CCTCCTCTGGAGAGAGAGGCTGG - Intergenic
1108180239 13:47833545-47833567 GCTGGTGTGCAGAGAGAAACAGG - Intergenic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108569453 13:51735069-51735091 CCCTGTGTGCAGAGAGATGCAGG + Intronic
1109292027 13:60488049-60488071 CTTACTGTGCAGTGAGCAGCAGG - Intronic
1109522129 13:63527452-63527474 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1110537376 13:76667145-76667167 CTTTCTGTGCAGCGAGCAGCAGG - Intergenic
1111201909 13:84949071-84949093 CTTTCTTTGCAGAGAGCAGCAGG + Intergenic
1111558628 13:89913819-89913841 CTTTCTGTGCTGAGAGCAGCGGG + Intergenic
1113753318 13:112791408-112791430 CCTCATCTGCAGGGAGAACCAGG - Intronic
1113870530 13:113556924-113556946 CCACCTGGGGAGAGAGCAGCTGG + Intergenic
1114393525 14:22336105-22336127 TCACCTGTTCAGAGAGGAGCTGG - Intergenic
1114529744 14:23388328-23388350 TCACCTGGGCAGAAAGAAGCTGG - Exonic
1118091441 14:62484694-62484716 CCTCCTCTGCATTGTGAAGCAGG + Intergenic
1119022008 14:71124076-71124098 TCACTTGTGCAGAGACAAGCAGG - Intergenic
1119039461 14:71259750-71259772 CCTACTGTGAGGAGAGCAGCTGG - Intergenic
1119372777 14:74161821-74161843 TCTTCTGTGCAGCGACAAGCAGG - Intronic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1120865784 14:89294195-89294217 CCTGCTGTGGGGAGAGAGGCTGG - Intronic
1121579416 14:95015962-95015984 CCTTCTGTACAACGAGAAGCAGG - Intergenic
1121876849 14:97460680-97460702 CCTTCAGGGCAGAGAGAAGATGG + Intergenic
1122631868 14:103111004-103111026 GCAGCTTTGCAGAGAGAAGCGGG - Intergenic
1122640711 14:103157396-103157418 CCTCCTCTGTAGTGAGAAGTGGG - Intergenic
1122974336 14:105164896-105164918 CCTCCTGAGCTGATAGACGCAGG + Intronic
1122997771 14:105274826-105274848 CCCACTGTGCAGACAGAAGTGGG - Intronic
1123040582 14:105488644-105488666 CCACCTGTGCAGAGAGAGACAGG - Intronic
1123411870 15:20067527-20067549 CCTCTTCTCCAGTGAGAAGCAGG - Intergenic
1123521214 15:21074646-21074668 CCTCTTCTCCAGTGAGAAGCAGG - Intergenic
1123578298 15:21694728-21694750 CCTCTTCTCCAGTGAGAAGCAGG - Intergenic
1123614923 15:22137210-22137232 CCTCTTCTCCAGTGAGAAGCAGG - Intergenic
1124069278 15:26376490-26376512 CTTTCTGTGCAGTGAGCAGCTGG - Intergenic
1124493322 15:30171714-30171736 CCCCCTGGGCTGAGAGCAGCTGG - Intergenic
1124750212 15:32366611-32366633 CCCCCTGGGCTGAGAGCAGCTGG + Intergenic
1125378490 15:39060238-39060260 CCTCCAGGGAAGAGAGAAACTGG + Intergenic
1125470513 15:39997905-39997927 CTTACTGAGCAGAGTGAAGCAGG + Intronic
1126189955 15:45868861-45868883 CCTCATATTCAGGGAGAAGCAGG + Intergenic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1128300522 15:66563995-66564017 CCTCCTGTGCAGACAGGGGTGGG + Exonic
1129229932 15:74191431-74191453 CCTCCTTTGCAGGAAGAAGCTGG - Exonic
1130375872 15:83328057-83328079 CCTCCTGCCCAGAGAGGAACAGG + Intergenic
1130709338 15:86264413-86264435 CCTTCTGTGCAGGGTGAAGACGG + Exonic
1130918693 15:88325944-88325966 CATCCTGTGCAGAAAGAATCAGG - Intergenic
1131342955 15:91619869-91619891 TTTCCTGTGAAGAGAGAGGCTGG + Intergenic
1131532158 15:93203031-93203053 CCTCTTGGGCAGAGAGAAGAAGG - Intergenic
1202987168 15_KI270727v1_random:428973-428995 CCTCTTCTCCAGTGAGAAGCAGG - Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133942220 16:10319096-10319118 TCTCCTGTGCGGATAGAATCAGG + Intergenic
1134040554 16:11065137-11065159 CCTCCTGAACAGGGACAAGCAGG + Intronic
1134596092 16:15497121-15497143 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1134597394 16:15506871-15506893 CTTTCTGTGCAGCGAGTAGCAGG + Intronic
1134644282 16:15853907-15853929 CCTCCTGAGTAGAGAGTAGCTGG - Intronic
1135051794 16:19199278-19199300 CCTCCTGTGTAGAATGAAGGAGG - Intronic
1135327594 16:21536908-21536930 CCTCCCGTGCTGAGACAAGATGG - Intergenic
1135921333 16:26651380-26651402 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1135927123 16:26705287-26705309 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1135942413 16:26834121-26834143 CCTTCTGTGTAGTGAGCAGCAGG + Intergenic
1135983866 16:27169332-27169354 CTTCCTGAGTAGAGAGTAGCTGG - Intergenic
1136337946 16:29622928-29622950 CCTCCCGTGCTGAGACAAGATGG - Intergenic
1139328967 16:66172981-66173003 CCTCCTGTGCTGGGAGGGGCAGG + Intergenic
1140709940 16:77668052-77668074 CCTCCTGGGTAGCGAGTAGCTGG - Intergenic
1140892620 16:79298181-79298203 CCCCATGGGCAGAGAGAGGCTGG - Intergenic
1141395079 16:83697409-83697431 CCTTCTGTGCCCAGAGACGCTGG - Intronic
1141723170 16:85768113-85768135 ACACCTGGGCAGAGGGAAGCAGG - Intergenic
1141884424 16:86881995-86882017 TCTGCTGTGCAGAGAGAAGCTGG - Intergenic
1142110890 16:88330652-88330674 CCTCCTGTGCTGACTGAGGCAGG - Intergenic
1142603437 17:1068722-1068744 CCTCCCGGGTAGAGAGAAGGAGG + Intronic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1145183454 17:20773352-20773374 CTTTCTGTGCAGAGAGCAGCAGG + Intergenic
1146745489 17:35324929-35324951 CTTTCTGTGCAGGGAGCAGCAGG + Intergenic
1147002488 17:37373912-37373934 CCTCCTCTGCTAAGAGAAGCAGG + Intronic
1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG + Intergenic
1150329324 17:64282488-64282510 CCACTAGTGCAGAGAAAAGCTGG + Intergenic
1151740490 17:75978919-75978941 CCTCCTTTCCCGAGAAAAGCTGG - Intronic
1151766088 17:76133951-76133973 CCTCCTGTGTAGAGAGTAGCTGG + Intergenic
1151851357 17:76692028-76692050 CCTCCTGAGCACAGAGAGGCTGG + Intronic
1151930295 17:77227930-77227952 CCAACGGTGCGGAGAGAAGCGGG - Intergenic
1152305218 17:79516408-79516430 GCTCCTGGGCAGAGAGACACAGG + Intergenic
1152356980 17:79812215-79812237 GTCCCTGTGCAGAGAGAAGTCGG - Intergenic
1152755040 17:82083710-82083732 CCTCCGGCCCAGGGAGAAGCAGG - Intronic
1154046960 18:10915241-10915263 TCACGTGTGCAGAGGGAAGCAGG + Intronic
1154174702 18:12077787-12077809 TCACGTGTGCAGAGGGAAGCAGG - Intergenic
1154402766 18:14057301-14057323 ACTCCTGAGAAGAGAGCAGCAGG - Intergenic
1154408408 18:14118747-14118769 CCTCCTATCAAGAGAGATGCAGG + Intronic
1155151916 18:23129821-23129843 TCTCCTGTGTAGGGAGAAGAGGG + Intergenic
1155344641 18:24846424-24846446 CCTCCTGGGGAAGGAGAAGCTGG + Intergenic
1156791103 18:40976065-40976087 CCATCTGTGGAGATAGAAGCAGG + Intergenic
1159327295 18:66938641-66938663 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1161487209 19:4542885-4542907 CCCACTCTGCAGAGGGAAGCGGG - Exonic
1161646732 19:5457499-5457521 CCTCCTGAGTAGCGAGCAGCTGG - Intergenic
1162352223 19:10157826-10157848 CCACCTGTGCAGCGGGGAGCGGG - Intronic
1163004775 19:14390221-14390243 CTTCCTGGAGAGAGAGAAGCTGG + Intronic
1163606393 19:18278146-18278168 CATCCTGTGCTGTGAGATGCGGG - Intergenic
1164463316 19:28466653-28466675 GCTGCTGTGCTGTGAGAAGCAGG + Intergenic
1164814136 19:31181408-31181430 CCATCTGAGCAGAGAGAAGAAGG + Intergenic
1164837350 19:31365511-31365533 GCTACTGTGGATAGAGAAGCTGG - Intergenic
1164886682 19:31784210-31784232 CAGCCTTTGCAGTGAGAAGCTGG - Intergenic
1165318542 19:35072399-35072421 CCTGCTCAGCAGAGAGAGGCTGG - Intergenic
1165438082 19:35807606-35807628 CCTCGTGTTCAAAGAGTAGCAGG - Intronic
1165605697 19:37101955-37101977 CCATCTGTGCAGAGACATGCTGG - Intronic
1165838215 19:38771996-38772018 CCTGCTGTGCGGGGAGGAGCAGG - Exonic
1165841348 19:38790701-38790723 CCTGCTGTGCGGGGAGGAGCAGG + Exonic
1166066970 19:40365854-40365876 CAGCCTGTCCAGACAGAAGCTGG + Exonic
1166966483 19:46532155-46532177 CCTGCTGTGCAGTGGGAAGTAGG - Intronic
1168179864 19:54654608-54654630 CCTCCAGGGCAGAGACAAGGTGG - Intronic
1168538317 19:57190559-57190581 CCTTCTGTGCAGCAAGCAGCAGG + Intergenic
1168595864 19:57676236-57676258 CCTGCTGTTCAGAGAGAAGAAGG + Exonic
925155049 2:1642557-1642579 ACTCTTGTGGTGAGAGAAGCAGG - Intronic
925466292 2:4109520-4109542 GCTACTGTACAGAAAGAAGCGGG - Intergenic
925931201 2:8709491-8709513 CCTGCTGTGCAGGCAGGAGCAGG + Intergenic
926239686 2:11075399-11075421 CCCCCTGTGCTGAGAGCTGCTGG - Intergenic
928103182 2:28451454-28451476 ACTCCACTGCAGAGAGAAACTGG + Intergenic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
928613728 2:33016177-33016199 CCCTCTGTGCAGAGACAAGGAGG + Intronic
931073184 2:58678183-58678205 CCTCATGTGCAGGTAAAAGCTGG - Intergenic
931261900 2:60627415-60627437 TCTCCTGTGCAGAAAGGAGTGGG + Intergenic
933007199 2:77010704-77010726 CATCCTGGGCAGAGAAAAGAAGG - Intronic
934604839 2:95686835-95686857 CATCGTGTGCAGAGAGAATGGGG + Intergenic
935765640 2:106365038-106365060 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
936467693 2:112767807-112767829 CTTTCTGTGCAGCGAGCAGCAGG - Intergenic
936538288 2:113329371-113329393 CATCGTGTGCAGAGAGAATGGGG + Intergenic
937047547 2:118859613-118859635 GCAGGTGTGCAGAGAGAAGCGGG + Intergenic
937862306 2:126720686-126720708 CCCCCTGTGGAGAGAGACTCTGG + Intergenic
937901235 2:127020728-127020750 TCTCCATTGCAGAGAGATGCTGG - Intergenic
938343242 2:130549179-130549201 CCTCCTGTGAAGTGAGAGGAGGG - Intronic
938346591 2:130571543-130571565 CCTCCTGTGAAGTGAGAGGAGGG + Intronic
938998676 2:136708263-136708285 ACGCCAGGGCAGAGAGAAGCTGG + Intergenic
940180168 2:150923344-150923366 ACACCTGTGCAGAGAGAATAAGG + Intergenic
940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG + Exonic
940659899 2:156533162-156533184 CTTCCTGTCCAGAGTGAAACAGG + Intronic
940769750 2:157827303-157827325 CCCACTGTGCAGAGAGAACAAGG + Intronic
942121123 2:172778516-172778538 ATTCCTGTGCAGAGATAATCAGG - Intronic
943112293 2:183621494-183621516 CCAGCTCTGAAGAGAGAAGCAGG - Intergenic
944417328 2:199491890-199491912 CCTTCTGGACAGAAAGAAGCGGG - Intergenic
946423952 2:219582208-219582230 CCTCCTGTGGAGAGACAAGAAGG - Intergenic
946715873 2:222554765-222554787 CCTGCTTTGCAGACAGCAGCGGG + Intronic
946747343 2:222859786-222859808 GCAGCTCTGCAGAGAGAAGCAGG - Intergenic
946938117 2:224742862-224742884 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
947483130 2:230521628-230521650 CTTTCTGTGCAGTGAGCAGCTGG + Intronic
947876639 2:233471877-233471899 TCTGCTGTGCAGAGAGAGGCAGG + Exonic
947949903 2:234137980-234138002 CCTCCTGTGCCGGGAGACTCTGG + Intergenic
948861849 2:240756535-240756557 TGCCCTTTGCAGAGAGAAGCTGG - Intronic
1168830697 20:843900-843922 TATGCTGTGCTGAGAGAAGCTGG - Intronic
1168951014 20:1802408-1802430 CCACCCGCGCAGAGCGAAGCTGG + Intergenic
1170231140 20:14048114-14048136 CTTTCTGTGCAGTGAGCAGCAGG - Intronic
1171485261 20:25481385-25481407 GCTCCTCTGCAGAGAGAATGGGG - Intronic
1172875482 20:38161516-38161538 CGACCTGTGCCGGGAGAAGCTGG - Exonic
1176181720 20:63752565-63752587 CCCCCTGTGCAGAGTGGACCCGG + Intronic
1176260723 20:64178090-64178112 GCCTCTGTGAAGAGAGAAGCTGG - Intronic
1177005678 21:15669385-15669407 CCTGCTGTGAACTGAGAAGCTGG + Intergenic
1177845838 21:26286583-26286605 ACCCCTGTGCAGAGAGAATGTGG - Intergenic
1178438077 21:32576783-32576805 CTCCCTGTGCAGAGAGACGGGGG - Exonic
1178689546 21:34739820-34739842 CCCCCTGTGAAGAAAGATGCTGG - Intergenic
1178790069 21:35691677-35691699 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
1178835486 21:36094041-36094063 CTTTCTGTGCAGTGAGAAGCGGG + Intergenic
1178918576 21:36723449-36723471 CCTCCTGGGCACAGTGCAGCTGG + Intronic
1181107999 22:20585969-20585991 CCTCCTGCACAGACAGCAGCGGG + Intronic
1181437919 22:22921137-22921159 CCTCCAGGACAGAGAGTAGCAGG + Intergenic
1182462742 22:30494106-30494128 CCTCCTGGGGAGGGAGAAGCAGG - Intronic
1182653896 22:31874282-31874304 CCTTCTGTTCAGAGAGCAGCTGG - Exonic
1182832365 22:33314228-33314250 ACTCCTGTGCACAGAGAACTTGG - Intronic
1183012544 22:34958762-34958784 CTTCATGTGCAGAGAGAAAGTGG + Intergenic
1183272622 22:36871633-36871655 CTTGCTGTGGAGAGAGAAGAGGG - Exonic
1183396556 22:37574779-37574801 CCTCCTCTGCAGAGAGGAGGCGG - Intronic
1183565787 22:38614190-38614212 GCTACTGTGCAAAGAGACGCAGG + Intronic
1184412966 22:44336503-44336525 CCTCCTCTGCAGTGAGGTGCCGG + Intergenic
1184846933 22:47093864-47093886 CTTTCTGTGCAGTGAGCAGCAGG - Intronic
1184932713 22:47693028-47693050 CCCATTGTGCAGAGAGAAGGTGG - Intergenic
1184950787 22:47841276-47841298 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
949134827 3:551723-551745 CTTTCTGTGCGGAGAGCAGCAGG + Intergenic
950187498 3:10954055-10954077 CATGCTGTGCTGAGAGCAGCTGG - Intergenic
953292905 3:41684269-41684291 ACTGGTGTGCACAGAGAAGCAGG - Intronic
953358389 3:42273709-42273731 CCTCAGCTTCAGAGAGAAGCTGG - Intergenic
954133595 3:48572035-48572057 CATTCTGTGCAGGGTGAAGCTGG - Exonic
955158211 3:56438485-56438507 CCTTCTGTGCAGCAAGCAGCAGG + Intronic
955621619 3:60870468-60870490 CCTACTGTGGAAAGAGATGCAGG + Intronic
955732762 3:62004665-62004687 CTTTCTGTGCAGCGAGCAGCCGG + Intronic
956948372 3:74251531-74251553 CCTCCTTTGCCTAGAGATGCAGG + Intergenic
959935952 3:112028424-112028446 GCCCCTGTGCTAAGAGAAGCAGG - Intergenic
960131080 3:114056744-114056766 CCTCCAGTGCAGAGCCAATCAGG - Exonic
961747008 3:129070477-129070499 CTTTCTGTGCAGTGAGCAGCGGG - Intergenic
962829281 3:139125810-139125832 CCTGCTGAGCAGACAGAAGTGGG + Intronic
963225890 3:142861227-142861249 CCTCCTCTGCAGAGAGTTGTAGG + Intronic
963843688 3:150133333-150133355 CCTCCAGGGAAGTGAGAAGCAGG + Intergenic
964137640 3:153363235-153363257 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
967465941 3:189806247-189806269 CCTTCTGTGTAGCTAGAAGCAGG + Intronic
967493579 3:190120017-190120039 CCTCTTTTTGAGAGAGAAGCTGG + Intronic
968867608 4:3223723-3223745 CCTCCTGGTCAGTGAGAAGCTGG + Intronic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969272195 4:6110577-6110599 CCTACTGTGCAGATAGCACCAGG - Intronic
969386367 4:6851875-6851897 CCTGCTGTGCTGTGTGAAGCTGG - Intronic
969636766 4:8373974-8373996 GCTCCTGGGCAGAGTGAAGCAGG + Intronic
969686061 4:8674923-8674945 CCTGTTTTGCAGAGAGAAGAGGG - Intergenic
969726768 4:8922819-8922841 CCACCTGTGCAGAGACCTGCTGG + Intergenic
970205921 4:13655277-13655299 GCCCTTGGGCAGAGAGAAGCAGG + Intergenic
970401177 4:15719269-15719291 CTTACTGTGCAGCGAGATGCTGG + Intronic
970720351 4:18981001-18981023 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
972045270 4:34657296-34657318 CTTACTGTGCAGTGAGCAGCAGG + Intergenic
972652015 4:41027203-41027225 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
973719094 4:53705372-53705394 GTTCCTGTGCAGAGGGAAGGAGG + Intronic
974618437 4:64322363-64322385 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
975276317 4:72505827-72505849 CTTCCTATGCAGAGAGATCCTGG - Intronic
976494524 4:85712220-85712242 CCTCCTGTTAAGAGAGAAGAGGG + Intronic
976869612 4:89775197-89775219 CCTCTTGTGGACAGAGAAACAGG - Intronic
977102657 4:92837007-92837029 CCTTCTGTGCAGCCAGCAGCAGG - Intronic
979155548 4:117384700-117384722 CCTCCCGTGTAGTGAGTAGCTGG + Intergenic
982100327 4:151960842-151960864 CTTTCTGAGCAGACAGAAGCAGG - Intergenic
982274047 4:153621828-153621850 CCTGCTGCCCAGAGAGAGGCAGG + Exonic
982448316 4:155521505-155521527 CTTCCTGTTCAGCGAGAAGCAGG - Intergenic
983238921 4:165209110-165209132 CTTCCTGGGCTGACAGAAGCAGG + Intronic
983583343 4:169330449-169330471 AATCCTGGGCAGAGAGAGGCAGG - Intergenic
984030928 4:174603167-174603189 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
984783673 4:183549059-183549081 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985284793 4:188326031-188326053 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985295248 4:188430987-188431009 CTTTCTGTGCAGCGAGTAGCAGG - Intergenic
985411836 4:189693797-189693819 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
986777265 5:11027838-11027860 CCGCTTGTGCAGAAAGGAGCTGG + Intronic
988039607 5:25872739-25872761 CCTTCTGTGCGGTGAGCAGCAGG + Intergenic
990815030 5:59774807-59774829 CCTCCTGAGTAGTGAGTAGCTGG + Intronic
992900687 5:81292115-81292137 ACACCTGTGCAGAAAGAAGTGGG - Intergenic
994450657 5:99937832-99937854 TCTCCTGTTCAGAAAGAAGATGG + Intergenic
994817435 5:104601953-104601975 CCTTCGGTGCAGACAGAACCTGG - Intergenic
997212459 5:132085497-132085519 GCTGCTGTGGGGAGAGAAGCAGG - Intergenic
997551004 5:134753309-134753331 CCTCCTGAGTAGTGAGTAGCTGG + Intergenic
998666039 5:144298418-144298440 CAGCCTTTACAGAGAGAAGCTGG + Intronic
999324722 5:150636774-150636796 TCCCCTGTGCAGAGAGAACGCGG + Intronic
1000328353 5:160188649-160188671 CCTTCTCCGCAGGGAGAAGCCGG - Intronic
1001448839 5:171808390-171808412 CCACCTCTGCAGAGGGATGCGGG + Intergenic
1001482132 5:172095767-172095789 CTCCCTGTGCCTAGAGAAGCAGG - Intronic
1002427589 5:179185363-179185385 CCGCCTGAGCAGGGAGAGGCTGG + Intronic
1002633769 5:180597051-180597073 CCTGCTGTGCGGAGGGGAGCAGG + Intergenic
1002874482 6:1199531-1199553 CCTCCAGTGGAGAGAGACCCAGG + Intergenic
1003119769 6:3309833-3309855 CCTGCTGTGCAGTGAGGGGCTGG - Intronic
1003333994 6:5153455-5153477 CCAGCTGGGCAGAGAGAAGCTGG + Intronic
1004000689 6:11594359-11594381 CCTTCGGTCCAGAGAGAGGCTGG - Intergenic
1004567583 6:16813245-16813267 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1007187394 6:39983962-39983984 CTTCCTGGGCAGAGAGGTGCAGG - Intergenic
1007515857 6:42410963-42410985 CCTCCTGTCTGGAGAGATGCTGG + Intronic
1007634059 6:43287486-43287508 GCTCCAGTGCTGAGTGAAGCTGG - Exonic
1011030622 6:82918995-82919017 CCTCCTGTGCAGAGAGTAGCAGG + Intronic
1012464832 6:99505549-99505571 CCTCCTGGGCTGGGAGTAGCTGG - Intronic
1013008291 6:106095814-106095836 CATCCTGTGCTGAGAAATGCTGG + Intronic
1013957498 6:115857534-115857556 CCTCATGTGCAAAGAGGAGCTGG + Intergenic
1014268978 6:119314659-119314681 CCTTCTGTGCATGGAGGAGCAGG - Intronic
1014495065 6:122111280-122111302 CTTCCTGTGCTGTGAGCAGCAGG + Intergenic
1014960241 6:127674443-127674465 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1015601635 6:134916329-134916351 TCTCCTGGGCAAAGACAAGCTGG + Intergenic
1017110071 6:150924120-150924142 CCCACTGGGCAAAGAGAAGCAGG + Intronic
1017501756 6:155032235-155032257 ATTCCTGTGCACAGACAAGCAGG - Intronic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1018805845 6:167258874-167258896 CCTGCTCTGAAGAGAGCAGCTGG + Intergenic
1019052453 6:169193471-169193493 GCTTCTATGCAAAGAGAAGCAGG + Intergenic
1019382548 7:731954-731976 CCTTCTGTGCAGAGAGGATGGGG - Intronic
1019731185 7:2630501-2630523 CCTCCTGTGTACTGAGAAACAGG - Intergenic
1019963963 7:4484003-4484025 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1019998934 7:4743752-4743774 CCTCAGGTCCAGAGAGAAGCAGG + Intronic
1020101041 7:5394590-5394612 CCTCGCCTGCAGAGAGAAGTTGG + Exonic
1020127041 7:5538927-5538949 CCACATGTGCAGAGAGGAACTGG + Intronic
1021515095 7:21475576-21475598 CCTCCTGAGTAGCGAGTAGCTGG + Intronic
1022456695 7:30564245-30564267 CCTCTTCTGCAGAGAGAAGGTGG - Intergenic
1022974862 7:35547707-35547729 GCACCTGTGGAGAGGGAAGCCGG + Intergenic
1023132781 7:37019295-37019317 CCTCCTTTGCAGGGAGATACAGG + Intronic
1023939302 7:44759725-44759747 TATCCTGTGCAGGGAGCAGCAGG + Intronic
1024654786 7:51442500-51442522 CCTTCTGTGCAGGGAGCAGCAGG - Intergenic
1025019173 7:55467289-55467311 CCCCATGTGCACAGAGCAGCTGG - Intronic
1026986409 7:74557758-74557780 GCTGCTGTGCACAGAGAAGTGGG + Intronic
1028080883 7:86574134-86574156 CCTCCTGAGTAGGGAGTAGCTGG - Intergenic
1029021844 7:97372325-97372347 CCTTCTGTGCAGTGAGCAGCAGG + Intergenic
1029689774 7:102173599-102173621 CTTCCTTTGCAGAATGAAGCAGG - Intronic
1032919286 7:136527544-136527566 GCTCCTGGGCAGAAAGAAGTGGG - Intergenic
1033563376 7:142555341-142555363 CCTCCTGTGCAGAAAACCGCAGG + Intergenic
1034355751 7:150449690-150449712 CCTGCTGTGCAGAGCGCAGAGGG + Intergenic
1034480808 7:151319317-151319339 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1035324728 7:158057615-158057637 CCTCCTGAGCAAAGGGAAGTGGG + Intronic
1035361532 7:158316731-158316753 CCTCCTGGGCGGTGAGGAGCTGG - Intronic
1035476911 7:159150091-159150113 CCTGGAGTTCAGAGAGAAGCAGG + Intergenic
1035921817 8:3685390-3685412 CATTCTGTGCAGTGAGCAGCAGG - Intronic
1036802820 8:11805214-11805236 CCTAGTTTGCAGAGAGAAACTGG - Intronic
1036950173 8:13132962-13132984 CTTGATGTGCAGAAAGAAGCCGG - Intronic
1037374437 8:18212624-18212646 CCTCCTTTGCAGAGAGCAAGAGG - Intronic
1037973668 8:23193155-23193177 CTTTCTGTGCAGCGAGCAGCGGG + Intronic
1039269719 8:35867742-35867764 ATTTCTGTGCAGAGAGCAGCAGG - Intergenic
1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG + Exonic
1040650494 8:49443592-49443614 CTTTCTGTGCCGAGAGCAGCAGG - Intergenic
1040650502 8:49443692-49443714 CTTTCTGTGCCGAGAGCAGCAGG - Intergenic
1040659205 8:49549592-49549614 CTTTCTGTGCAGGGAGCAGCAGG - Intronic
1040659435 8:49553007-49553029 CTTTCTGTGCGGAGAGCAGCAGG + Intronic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1042061265 8:64820729-64820751 CCTCATGTGCAGAGAGCTCCTGG - Intergenic
1042886171 8:73554478-73554500 CCTTCTAGGCAGAAAGAAGCTGG + Intronic
1043398675 8:79862654-79862676 CCTCCTGTGCACAGAACAGGCGG + Intergenic
1044014007 8:87028463-87028485 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1044274578 8:90285150-90285172 CATTCTGTGCTGAGAGCAGCAGG + Intergenic
1047080832 8:121458524-121458546 CTTTCTGTGCAGAGAGCAGCAGG - Intergenic
1047681366 8:127257666-127257688 GGTCCTGTGGAGTGAGAAGCGGG + Intergenic
1048268225 8:133005952-133005974 CCTCCAGTGCAGGGAGAAGATGG - Intronic
1049766861 8:144358955-144358977 CCTCCTCTCCAGGGAGAGGCGGG - Exonic
1050793751 9:9509710-9509732 CTTTCTGTGCAGTGAGTAGCAGG + Intronic
1051777104 9:20646902-20646924 GCTCCTGTGGACAGAGAAGCAGG + Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1055030333 9:71767700-71767722 CCAACTCTGCAGAGAAAAGCTGG + Intronic
1055145667 9:72931693-72931715 CCTCTTGTGCAGAGGGAACAGGG + Intronic
1055172776 9:73280388-73280410 CCTCCTGAGCATAAAGAACCAGG - Intergenic
1055189866 9:73504926-73504948 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1056627054 9:88262564-88262586 CTTTCTGTGCTGAGAGCAGCAGG - Intergenic
1057254085 9:93529331-93529353 CCTACAGTGCAGAGAGCAGAAGG - Exonic
1057395787 9:94678851-94678873 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1057846686 9:98531367-98531389 ACTCCAGAGCAGAGAGAAGATGG - Intronic
1058120732 9:101135837-101135859 CCTGCTGGGCAGACAGAGGCAGG - Intronic
1059419178 9:114180587-114180609 CCATCTGTGCAGAGAGGAGCTGG - Intronic
1060779003 9:126398091-126398113 CCTCATGTGCAGGGAGCACCGGG - Intronic
1060783121 9:126428122-126428144 CCCCTTGTACAGAGAGAAGGAGG + Intronic
1061055448 9:128220073-128220095 CCCCCTGCGCAGAGGTAAGCAGG + Exonic
1061071173 9:128311578-128311600 CCACGTGACCAGAGAGAAGCTGG - Exonic
1061898697 9:133662103-133662125 GCCCCTGTGGAGAGAGAACCTGG - Intergenic
1062074961 9:134582713-134582735 CCTCCTCTGCAGACAGAATCTGG + Intergenic
1062211803 9:135368733-135368755 CTTTCTGTGCAGAGAGCCGCAGG + Intergenic
1062288143 9:135782603-135782625 CCTCCTGTCCAGAAAGCAGGAGG + Intronic
1062443439 9:136583647-136583669 CCACCCGTGCAGAGTGGAGCAGG + Intergenic
1203670760 Un_KI270755v1:9184-9206 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1185527563 X:791529-791551 CCCACTGTGCAGAGAGAAAAAGG + Intergenic
1186057641 X:5667019-5667041 CCTCCTGAGTAGCGAGTAGCTGG + Intergenic
1186339008 X:8623144-8623166 CCTCCTGTACAGTTAAAAGCGGG + Intronic
1186471103 X:9822746-9822768 ACACCTGGGCAGAGAGGAGCTGG - Intronic
1186976318 X:14909405-14909427 CGTACTGTGAAGAGAAAAGCAGG - Intronic
1188805175 X:34579135-34579157 CCTCCTGTGAATGGAGAAGGGGG + Intergenic
1190261214 X:48798511-48798533 CCTCCTCTGCAGATAGATGTGGG + Intergenic
1191027574 X:55930962-55930984 CCTGAGGTACAGAGAGAAGCTGG - Intergenic
1194725665 X:97393181-97393203 ACTCCTTTGAAGAGAGAATCAGG - Intronic
1195465714 X:105176676-105176698 CCACCTGTGGGGAGAGAAGGGGG + Intronic
1196294103 X:113979196-113979218 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1196294946 X:113986531-113986553 CCTTCTGTGCAATGAGCAGCAGG + Intergenic
1196872386 X:120125317-120125339 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1200091284 X:153637290-153637312 GCTCCTGGGCAGAGAGAAGGTGG - Intergenic
1200940434 Y:8774807-8774829 ACTCCTATGGAGTGAGAAGCAGG - Intergenic