ID: 1091258796

View in Genome Browser
Species Human (GRCh38)
Location 11:134217209-134217231
Sequence AACATTTAGCAGTAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091258796_1091258798 -8 Left 1091258796 11:134217209-134217231 CCTGGCTCCTACTGCTAAATGTT 0: 1
1: 0
2: 0
3: 9
4: 165
Right 1091258798 11:134217224-134217246 TAAATGTTTACCATCTTCAAAGG 0: 1
1: 1
2: 1
3: 26
4: 267
1091258796_1091258801 20 Left 1091258796 11:134217209-134217231 CCTGGCTCCTACTGCTAAATGTT 0: 1
1: 0
2: 0
3: 9
4: 165
Right 1091258801 11:134217252-134217274 AAACAAAATATCAAAATTAAAGG 0: 1
1: 1
2: 11
3: 314
4: 2667
1091258796_1091258799 -7 Left 1091258796 11:134217209-134217231 CCTGGCTCCTACTGCTAAATGTT 0: 1
1: 0
2: 0
3: 9
4: 165
Right 1091258799 11:134217225-134217247 AAATGTTTACCATCTTCAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091258796 Original CRISPR AACATTTAGCAGTAGGAGCC AGG (reversed) Intronic
900725655 1:4214816-4214838 AAAAAATAGCAGTTGGAGCCAGG + Intergenic
900771317 1:4547068-4547090 AACAATTAGCAGTATTAGCTGGG + Intergenic
901394811 1:8973317-8973339 AACATTTAGACCTAGGAGACAGG - Intronic
902794120 1:18789494-18789516 AACATTAAGCAAGAGGGGCCTGG - Intergenic
905728618 1:40277671-40277693 AAAATTTAGGATTAGCAGCCAGG + Intronic
907522716 1:55034923-55034945 AACATGTTGCAGTCGGAGCCAGG + Intergenic
908175609 1:61552514-61552536 AATAATTAGCAGCAGCAGCCGGG - Intergenic
910663746 1:89701887-89701909 AAAACTAAGCAGTAGCAGCCAGG + Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911561249 1:99408725-99408747 AAATTTTGGCAGTAGAAGCCAGG - Intergenic
913546732 1:119876341-119876363 AACATGAAGCAGTAAGACCCAGG + Intergenic
913557342 1:119981094-119981116 AACATGCAGCAGTAAGACCCAGG - Intronic
915921850 1:159981693-159981715 AAAATATAGCAGCAGGAGGCTGG - Intergenic
917966572 1:180182788-180182810 GCCATTCAGCAGCAGGAGCCTGG - Intronic
921627455 1:217393019-217393041 AACATTTAGCAATTTGAGGCAGG + Intergenic
923774162 1:236963472-236963494 GTCATTTAGCAGAAGTAGCCTGG + Intergenic
1066073235 10:31843535-31843557 AATAATTAAAAGTAGGAGCCTGG - Exonic
1066115746 10:32237962-32237984 AATATGTACTAGTAGGAGCCAGG + Intergenic
1069051428 10:63798936-63798958 AATATCTAGAAGTAGAAGCCAGG + Intergenic
1070407353 10:76108792-76108814 AAAATTTAGCAGCAAGAGGCTGG - Intronic
1071132722 10:82414084-82414106 AATGTTTAGCACAAGGAGCCTGG + Intronic
1071309728 10:84330982-84331004 AAGATTTAGAATTAGGAGACTGG - Intronic
1076238995 10:128888095-128888117 AACAGTTAGCAGCAGCAGCTTGG - Intergenic
1078999927 11:16743323-16743345 AATATTTCACAGTAAGAGCCAGG - Intronic
1083174533 11:60941258-60941280 AACATTGGCCAGGAGGAGCCAGG + Exonic
1085233774 11:74995247-74995269 AGCATTTAGTAGTAGAAGCGTGG - Intronic
1086339082 11:85828899-85828921 ATCATATTGCAGTAGGACCCTGG + Intergenic
1088689543 11:112313815-112313837 AGCATTCAGCAATAGGAGTCTGG - Intergenic
1089798902 11:121007291-121007313 AACATTTGGAAGTAGGATACAGG + Intergenic
1089868200 11:121650327-121650349 AACATCCAACATTAGGAGCCTGG + Intergenic
1090182802 11:124715776-124715798 AACTTTTATCAGCAGGAGTCTGG + Intergenic
1091258796 11:134217209-134217231 AACATTTAGCAGTAGGAGCCAGG - Intronic
1093903347 12:24661385-24661407 AATAATTAGCAGTAATAGCCAGG - Intergenic
1098393433 12:69993352-69993374 AACATTTAGCAATAGGAATTTGG - Intergenic
1100160569 12:91855600-91855622 ACCATTGAGAAGTAGGAGTCGGG - Intergenic
1104564524 12:129868818-129868840 ACCATGCAGCAGAAGGAGCCAGG + Intronic
1107046110 13:35994127-35994149 AACATTTAGCAGGAGTAGGTTGG + Intronic
1107754041 13:43600004-43600026 AATAATCAGCAGTAGGACCCAGG + Intronic
1109100728 13:58181023-58181045 AATAATCAGCAGTAGGGGCCAGG - Intergenic
1114567895 14:23645864-23645886 AACATTAAGAAGTATTAGCCTGG - Intergenic
1116791393 14:49343845-49343867 AACATTTACCAGCAGGGGCCAGG + Intergenic
1117437904 14:55734864-55734886 AAGCTTCAGCAGCAGGAGCCAGG + Intergenic
1119796441 14:77402328-77402350 AAAATTCAACAATAGGAGCCGGG + Intronic
1125336119 15:38627916-38627938 AATCTTCAGCAGTGGGAGCCAGG - Intergenic
1125350574 15:38762919-38762941 AACTTTAAGCAGTAGGAGAGAGG + Intergenic
1129234765 15:74217509-74217531 GTCATTGAGCAGCAGGAGCCTGG + Intergenic
1129651553 15:77494424-77494446 GAAAGTTAGCAGTAGGGGCCGGG - Intergenic
1130439910 15:83943054-83943076 CACATTTAGCTGTGGGAGACTGG + Exonic
1131326194 15:91448528-91448550 AACATGTACCAGTAGAACCCAGG - Intergenic
1138324173 16:56148372-56148394 AACTCTTAGCAGTGGAAGCCTGG + Intergenic
1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG + Intronic
1143304961 17:5939176-5939198 AACATTAAGAACTTGGAGCCGGG - Intronic
1146211468 17:30946843-30946865 GACACTTGGCAGCAGGAGCCAGG + Intronic
1149380582 17:56089570-56089592 AAGATTTGCCAGTAGGAGCTAGG + Intergenic
1154488836 18:14903266-14903288 AACATTTATTAATAGGTGCCTGG + Intergenic
1157012860 18:43672313-43672335 AACATTTGTCACTAGGTGCCGGG + Intergenic
1157371976 18:47122131-47122153 AACATTTAGCAAAAGGTACCAGG - Intronic
1159744555 18:72214922-72214944 AACAGGTACCAGTAAGAGCCAGG - Intergenic
1161643940 19:5441520-5441542 AACACCTAGCAGTGGGTGCCTGG + Intergenic
1162949905 19:14064921-14064943 AATATTTAGATGTTGGAGCCAGG + Intergenic
1165139641 19:33690976-33690998 CACATTCTGCAGGAGGAGCCTGG + Intronic
1165645383 19:37431526-37431548 AACAGTCAGCAGTGGTAGCCAGG + Intronic
1167204444 19:48091127-48091149 AACATTAAGCAGAAGGACCCAGG - Intronic
925506351 2:4569254-4569276 AATATTCAGCAGTAGTAGTCAGG - Intergenic
925843408 2:8013186-8013208 AACATGTATCAGCAGGAGCTGGG + Intergenic
926603925 2:14877367-14877389 AGTATATACCAGTAGGAGCCAGG - Intergenic
927429069 2:23011647-23011669 AACATATAGCAGTAGTAGAAGGG + Intergenic
928329925 2:30349844-30349866 AACCATTAGCAGCAGGAGGCAGG + Intergenic
930971027 2:57396612-57396634 AATAATCAGCAGTAGTAGCCAGG - Intergenic
931167011 2:59759063-59759085 AACATAAAGCAGCACGAGCCAGG - Intergenic
931167574 2:59764746-59764768 AACAATTAGCAGTTTGGGCCAGG + Intergenic
934946284 2:98544320-98544342 AACATGAAGCAGTAATAGCCCGG - Intronic
942903582 2:181153762-181153784 AATATTTAGCAGCAGGAGAGAGG + Intergenic
944864437 2:203846923-203846945 AACATTTAGCAATTTGTGCCAGG - Intergenic
944990540 2:205230295-205230317 AATAATTAGCAGCAGTAGCCAGG - Intronic
947871914 2:233443942-233443964 ACCATGGAGCAGTAGCAGCCAGG - Intronic
1169885240 20:10391388-10391410 AACATTTAGCAGATGCATCCAGG - Intergenic
1171108814 20:22461738-22461760 AACAAATAGAAGTTGGAGCCTGG - Intergenic
1174269970 20:49360822-49360844 AACGTTCAGGAGTAGGAGACTGG + Intergenic
1175791452 20:61742820-61742842 AACATTAACCAGTAGGCACCAGG - Intronic
1179624622 21:42641847-42641869 AAAATGGAGCAGTAGGACCCTGG - Intergenic
950083980 3:10243836-10243858 AACAGTCAACAGTAAGAGCCAGG - Intergenic
950303955 3:11904346-11904368 AAAATGCAGCAGTAGGAGACAGG - Intergenic
950478347 3:13228100-13228122 TGCATTTACCAGCAGGAGCCGGG - Intergenic
950505936 3:13394489-13394511 AAAATGCAGCAGTAGGAGACAGG + Intronic
950801101 3:15552405-15552427 AATAATCAGCAGTAGTAGCCAGG - Intergenic
952317791 3:32246661-32246683 TACATTGAACAGTAGGAGCCTGG - Intronic
952529007 3:34243979-34244001 ATCATTAAGCAAAAGGAGCCAGG - Intergenic
954103730 3:48397988-48398010 AGCATGGAGCAGTGGGAGCCTGG + Intronic
956997849 3:74848460-74848482 AACAATTATCCTTAGGAGCCGGG + Intergenic
961786356 3:129349553-129349575 TGCATTTATCAGCAGGAGCCGGG + Intergenic
962160815 3:132998430-132998452 AAAATTTAGCCGCAGGACCCTGG - Intergenic
963227143 3:142873970-142873992 TACATGTTGCAGGAGGAGCCTGG + Intronic
963240400 3:142997326-142997348 AATAATTAGCAGTGGCAGCCAGG - Intronic
965645393 3:170875233-170875255 AACATTTATCAGCAGGGGACAGG - Intergenic
966726666 3:183114976-183114998 AGCATTTAGCACCACGAGCCGGG - Intronic
967529380 3:190531553-190531575 AACATTCAGGAGTATGTGCCGGG - Intronic
968248322 3:197178641-197178663 AACATTTAGCAGTAGGAAAAAGG + Intronic
970515575 4:16826594-16826616 AACCTTTTGCGGGAGGAGCCTGG - Intronic
970859356 4:20683979-20684001 AACATTTAGCAATAGCACCCTGG - Intergenic
973772996 4:54223678-54223700 AACATTTAGCAAGATCAGCCTGG - Intronic
974738042 4:65965488-65965510 AAGATGTAGCAGTTGGAGTCTGG - Intergenic
977370969 4:96135580-96135602 AACATTTAGCATTATCACCCAGG + Intergenic
980165849 4:129226205-129226227 ACCATCTAACAGTAGAAGCCAGG - Intergenic
980205402 4:129713487-129713509 AAAGTTCAGGAGTAGGAGCCAGG + Intergenic
981558628 4:146023213-146023235 AACAATTAGCAGTAATACCCAGG - Intergenic
988335689 5:29906043-29906065 AATTTTTAGCAGTAGGTCCCAGG - Intergenic
990143570 5:52732946-52732968 AACATTTAGCTGGAGGAGGCTGG - Intergenic
990147424 5:52778412-52778434 AACCTTTGGCAGTAGGAATCAGG + Intergenic
990210994 5:53481189-53481211 AACAAGTATCAGTAGTAGCCTGG + Intronic
990278951 5:54229590-54229612 ATAATTTGGCAGGAGGAGCCTGG - Intronic
991118507 5:62982684-62982706 AGCAGGGAGCAGTAGGAGCCTGG - Intergenic
995952385 5:117731749-117731771 AATATGTAGCAATAGGAGCAGGG - Intergenic
998325175 5:141273797-141273819 AGCATATACCAGCAGGAGCCAGG + Intergenic
998690343 5:144580841-144580863 AACACTTAGCATCAGGAGCAAGG + Intergenic
999993093 5:157066789-157066811 AAAAGTTAGCAGTAAGGGCCGGG + Intergenic
1003733779 6:8854788-8854810 AACCTTTAGGAGTGGGACCCAGG + Intergenic
1004852190 6:19711582-19711604 AACATTGAGCAGAAGGAGAATGG + Intergenic
1005698054 6:28369897-28369919 TCCAATTGGCAGTAGGAGCCTGG + Intergenic
1006913249 6:37577908-37577930 AAAAGTTAGCAGCAGGATCCAGG - Intergenic
1009265484 6:61549581-61549603 AACATATAGCAATAGAAGGCAGG - Intergenic
1009542868 6:64986212-64986234 AACTTTTATCAGAAGGTGCCAGG + Intronic
1010434465 6:75813699-75813721 AACAGTCAGCAGTGGTAGCCAGG - Intronic
1010761219 6:79725428-79725450 AAAATTTAGCAGTTTGGGCCAGG + Intergenic
1012686840 6:102260946-102260968 AACATTTAGTAACAGAAGCCAGG - Intergenic
1013605542 6:111744156-111744178 AACATTTAACAGTAGGATAACGG - Intronic
1014568086 6:122975817-122975839 AACATTTAACAGTAAAAGACAGG - Intergenic
1015810570 6:137158395-137158417 AACATTTTGCAATGGCAGCCTGG - Exonic
1015830184 6:137360398-137360420 AAAATTTAGAAGTAGGAGCTGGG - Intergenic
1021378048 7:19932976-19932998 AACATTTAGCAGTATTTACCAGG - Intergenic
1021956674 7:25832129-25832151 GACTTTTAGCAGTAGGAAGCAGG - Intergenic
1026236219 7:68529311-68529333 AACATTTTGAGGTAGGAGGCGGG + Intergenic
1028533356 7:91863371-91863393 AATATTTAGGAGTAGGGGCTGGG + Intronic
1028901007 7:96100537-96100559 AGCATGTACCATTAGGAGCCCGG + Intronic
1030990320 7:116291493-116291515 AACAATCAGCAGTGGTAGCCAGG + Intronic
1034513959 7:151559168-151559190 AACATTGAACAGAGGGAGCCAGG - Intronic
1035157044 7:156922838-156922860 AACATTTAACAGCAGGAGAAAGG + Intergenic
1036531414 8:9592046-9592068 AAGATTTAACAGTAAAAGCCAGG + Intronic
1039384650 8:37123694-37123716 AAAATGTAGCAGTTTGAGCCAGG + Intergenic
1041606904 8:59792688-59792710 AATAGTCAGCAGTGGGAGCCAGG + Intergenic
1043232157 8:77816784-77816806 AACACATACCAGCAGGAGCCAGG + Intergenic
1044159571 8:88896407-88896429 AACATCTAACAGAAGGAACCAGG - Intergenic
1044533896 8:93338330-93338352 AACTTCTAGCAGAAGGAACCTGG - Intergenic
1045172556 8:99687024-99687046 AATAATTAGCAGTAGCACCCAGG - Intronic
1045382659 8:101642963-101642985 TACAATTTGCTGTAGGAGCCCGG - Intronic
1045715175 8:105034979-105035001 AACACTGAGCAGTAGTAGACAGG + Intronic
1046030304 8:108775375-108775397 AACTTGTAGCAGTAGGAAACAGG - Intronic
1047302026 8:123621729-123621751 CACAGTTAGCAGTAGGACCTGGG + Intergenic
1047342797 8:123999226-123999248 AATAATTAGCAGTGGTAGCCAGG - Intronic
1048098096 8:131315967-131315989 AACATCTAGCATCAGGAGGCAGG - Intergenic
1048128356 8:131663029-131663051 ATAATTCAGCAGCAGGAGCCAGG + Intergenic
1048989968 8:139755432-139755454 AGCATGTCGCAGGAGGAGCCAGG + Intronic
1048990036 8:139755705-139755727 AGCATGTCGCAGGAGGAGCCAGG + Intronic
1048990174 8:139756251-139756273 AGCAGGTCGCAGTAGGAGCCAGG + Intronic
1048990194 8:139756329-139756351 AGCATGTCGCAGGAGGAGCCAGG + Intronic
1048990310 8:139756797-139756819 AGCATGTCGCAGGAGGAGCCAGG + Intronic
1048990319 8:139756836-139756858 AGCATGTCGCAGGAGGAGCCAGG + Intronic
1048990357 8:139756992-139757014 AGCATGTCGCAGGAGGAGCCAGG + Intronic
1048990386 8:139757109-139757131 AGCATGTCGCAGGAGGAGCCAGG + Intronic
1048990413 8:139757225-139757247 AGCATGTCGCAGGAGGAGCCAGG + Intronic
1049055913 8:140237508-140237530 CAAATTTAGGACTAGGAGCCAGG + Intronic
1049167326 8:141134591-141134613 AAAATGTATCAGTAGGAACCAGG - Intronic
1049719873 8:144110860-144110882 ACCATTCAGCTGCAGGAGCCTGG - Exonic
1050009057 9:1166728-1166750 AATATCTAACAGTAGGAGACTGG + Intergenic
1051253729 9:15190184-15190206 GACATTTAGCAGAAGGAGTAGGG - Intronic
1054924825 9:70578895-70578917 AACATCTAGCAGTAGAGGCCAGG - Intronic
1055275078 9:74606157-74606179 AGCATATTACAGTAGGAGCCAGG - Intronic
1057493120 9:95538259-95538281 AATATTTAGGAGAAGAAGCCAGG - Intergenic
1058336164 9:103832161-103832183 AGCATCTGGCAGTAGCAGCCAGG + Intergenic
1188030788 X:25261218-25261240 AACTTTCAGCAGTGGGAGTCTGG + Intergenic
1188623016 X:32249821-32249843 AATATTTTGGAATAGGAGCCAGG + Intronic
1189593260 X:42537683-42537705 GACATTTGGCTGTAGGAGGCAGG + Intergenic
1192858515 X:75040057-75040079 AATAATCAGCAGTAGTAGCCAGG - Intergenic
1192941107 X:75912517-75912539 AATAATTAGCAGTGGTAGCCAGG - Intergenic
1201687990 Y:16728601-16728623 ACCATTTTGGAGAAGGAGCCTGG + Intergenic