ID: 1091259847

View in Genome Browser
Species Human (GRCh38)
Location 11:134225236-134225258
Sequence CCGTCTCCCCGTCGTAGAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091259847_1091259855 21 Left 1091259847 11:134225236-134225258 CCTCTTCTACGACGGGGAGACGG 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1091259855 11:134225280-134225302 CCCTCAAGAACCCCAACAAGCGG 0: 1
1: 0
2: 0
3: 9
4: 122
1091259847_1091259857 25 Left 1091259847 11:134225236-134225258 CCTCTTCTACGACGGGGAGACGG 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1091259857 11:134225284-134225306 CAAGAACCCCAACAAGCGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091259847 Original CRISPR CCGTCTCCCCGTCGTAGAAG AGG (reversed) Exonic
900553134 1:3266527-3266549 CCCTCTCCTCGTCGGAGGAGCGG - Intronic
922791420 1:228313317-228313339 CCCTCTCCCCTTCCTAGAGGTGG + Intronic
1065037715 10:21657061-21657083 CCTTCTTCCCATGGTAGAAGAGG + Intronic
1071858126 10:89645900-89645922 CCGCCTTCCCTTCTTAGAAGAGG - Intergenic
1074606266 10:114971109-114971131 CCGTATCCTCCTAGTAGAAGGGG + Intronic
1076820776 10:132938500-132938522 CCGTCCCCCCCCCGGAGAAGGGG + Intronic
1084781013 11:71408113-71408135 CCCTCTCCCCTTCGTGGAAGGGG + Intergenic
1089461285 11:118655843-118655865 CCCTCTCCCCTTCCCAGAAGAGG + Exonic
1091259847 11:134225236-134225258 CCGTCTCCCCGTCGTAGAAGAGG - Exonic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1107430012 13:40332114-40332136 CAGTCTCCCCTTCCTGGAAGAGG - Intergenic
1112498756 13:99926229-99926251 CCGCCTCCCTGTCGGTGAAGAGG + Intergenic
1122634654 14:103124261-103124283 CCGTTTCCCCGTCTTTGAAAAGG - Intronic
1122826979 14:104375216-104375238 CCGTCTCCCCCTCCTATAAGGGG - Intergenic
1122827017 14:104375324-104375346 CCATCTCCCCGTCCTGTAAGGGG - Intergenic
1122827029 14:104375359-104375381 CTGTCTCCCCGTCCTATAAGGGG - Intergenic
1122827041 14:104375395-104375417 CCATCTCCCCGTCCTGTAAGGGG - Intergenic
1122827053 14:104375430-104375452 CTGTCTCCCCGTCCTATAAGGGG - Intergenic
1122827065 14:104375466-104375488 CCATCTCCCCGTCCTGTAAGGGG - Intergenic
1122827077 14:104375501-104375523 CTGTCTCCCCGTCCTATAAGGGG - Intergenic
1129450450 15:75648330-75648352 CCCTCTCCCCGCCCCAGAAGTGG - Exonic
1132554669 16:567206-567228 CCGCCCCCCCGCCGTAGAAAGGG + Intronic
1132793438 16:1706471-1706493 CCACCTCCTCGTCGTAGCAGTGG - Exonic
1136258944 16:29060644-29060666 CCGCCACCCCGTCGGGGAAGTGG - Intergenic
1143402007 17:6652068-6652090 CCCTCTCCCCCTCGGGGAAGCGG + Exonic
1144292842 17:13842930-13842952 CTGTCTCCTCGTAGGAGAAGTGG - Intergenic
947815550 2:233034178-233034200 CCGTCTGCGCGTCATACAAGGGG - Exonic
948440231 2:237982269-237982291 CCCTATCCCCGTAGGAGAAGGGG + Intronic
953389936 3:42528081-42528103 CCGACTCCCCGCTGTCGAAGAGG - Exonic
991038154 5:62149024-62149046 CCCTCTCCCAGTGGTAGAAGTGG - Intergenic
1007234949 6:40383913-40383935 CAGTCTTCCCATCCTAGAAGGGG + Intergenic
1010136420 6:72559345-72559367 CTGTCTCCCAGTCTTAGAGGTGG + Intergenic
1035454948 7:159002021-159002043 CCGTCTCCCCGTGTGAGGAGGGG + Intergenic
1045396668 8:101767628-101767650 CCTTCTCAACATCGTAGAAGAGG - Intronic
1045482110 8:102600889-102600911 CTGTCTCTCCGTCCTAGAAGGGG + Intergenic
1203778506 EBV:87636-87658 CCGCCTTCCCGTAGGAGAAGGGG + Intergenic
1190275566 X:48897227-48897249 CGGGCTCACCGTCGGAGAAGGGG - Intronic
1192303320 X:69929823-69929845 CCGTCTCCCCATGGCAGGAGTGG - Intronic