ID: 1091263239

View in Genome Browser
Species Human (GRCh38)
Location 11:134250482-134250504
Sequence CTCCACAGAGACACTTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091263234_1091263239 18 Left 1091263234 11:134250441-134250463 CCACTGGCTATAGAGGAAGTATG 0: 1
1: 0
2: 14
3: 149
4: 1057
Right 1091263239 11:134250482-134250504 CTCCACAGAGACACTTTTGCTGG 0: 1
1: 1
2: 0
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091263239 Original CRISPR CTCCACAGAGACACTTTTGC TGG Intronic
904769647 1:32873650-32873672 CTCCACAGAGACCCCCTTGAGGG + Intergenic
905016193 1:34780591-34780613 CTCCACAGAGATGATATTGCTGG - Intronic
906196323 1:43932737-43932759 CGCCAAAGGCACACTTTTGCAGG + Intergenic
908358587 1:63345973-63345995 CTCCACAGAGCCACTCTAGGAGG + Intergenic
912011297 1:104966762-104966784 CTGGAGAGAGACACTTTTGCTGG - Intergenic
915673540 1:157510252-157510274 GTCCCCAGAGACACTCTTCCGGG - Intergenic
916553367 1:165871441-165871463 CTCCACAGGGACACAGCTGCAGG + Intronic
917265940 1:173220985-173221007 CTCCACAGAGAGGCCTTTGATGG - Intergenic
918042998 1:180924496-180924518 CTCCACACAGATCCTTTTGAAGG + Intronic
918069953 1:181127457-181127479 CTCTCCGGAGACACTTGTGCAGG - Intergenic
918204165 1:182294410-182294432 CTCCAAAGAGCTACTTTTCCTGG + Intergenic
921223148 1:212988599-212988621 CACCACAGAAACCCTCTTGCTGG - Exonic
1063555006 10:7070000-7070022 CACCACAGAGACATTTTAGAAGG + Intergenic
1065441977 10:25762291-25762313 CTCCACAGAGCCGAATTTGCTGG + Intergenic
1066523830 10:36253524-36253546 CTCCTTAGAGAGACATTTGCTGG + Intergenic
1067727251 10:48779550-48779572 CTCCACAGAGACTCCATTGTAGG - Intronic
1067791702 10:49293254-49293276 TTCCTCAGAGAGACTTTTCCTGG - Intergenic
1068314180 10:55320210-55320232 CTCCACTGTGCCACTGTTGCTGG + Intronic
1069756081 10:70775153-70775175 CTCCACTGAGACAGTGCTGCGGG + Intronic
1077418959 11:2440564-2440586 CTCCACAGAGACCCTGGAGCAGG - Intergenic
1080439673 11:32280327-32280349 ATCCAAAGAGAGATTTTTGCTGG + Intergenic
1081801292 11:45861044-45861066 CTGCCCAGAGCCACTTGTGCTGG + Intronic
1083769165 11:64856718-64856740 CTCCCCAGGGACACTGTGGCAGG + Intronic
1084046635 11:66572435-66572457 CCCCACAGGGACAGCTTTGCAGG - Intergenic
1084608717 11:70187300-70187322 CTCCACGGAGACATTTCTGGTGG - Intronic
1091263239 11:134250482-134250504 CTCCACAGAGACACTTTTGCTGG + Intronic
1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG + Exonic
1093319304 12:17693307-17693329 TTCCAAAGAGATAATTTTGCAGG + Intergenic
1094404453 12:30100439-30100461 CTGCACAGGGAAACTTTTGGAGG - Intergenic
1098826746 12:75306337-75306359 GTCCTCAGAGACACTGTTACAGG - Intronic
1099584626 12:84502079-84502101 CTCCAGAGTGACACCTCTGCAGG + Intergenic
1099747874 12:86730540-86730562 TTGCACAGAGACACTATTTCTGG - Intronic
1103844186 12:123890051-123890073 ATCCACAGAGTCCTTTTTGCAGG + Intronic
1105468940 13:20674081-20674103 TTCCACGCTGACACTTTTGCAGG + Intronic
1107735235 13:43392120-43392142 CTCCACAAAGACACTGTTCGTGG + Intronic
1110420313 13:75300276-75300298 TACCACAGAGACACTTGAGCTGG + Intronic
1110425794 13:75364823-75364845 CTCTGTAGAGACACTTTTGGAGG - Intronic
1111330800 13:86760721-86760743 CTCCTCATAGACACCTTTTCAGG - Intergenic
1111578853 13:90196306-90196328 CTCCAGAGAAACACTTGTGAAGG - Intergenic
1112917451 13:104569162-104569184 CTCTACAGAGATACTATTTCTGG + Intergenic
1113368188 13:109697877-109697899 CTTTACAAAGACACTGTTGCTGG - Intergenic
1115987432 14:39116334-39116356 CTCCTTAGAGAGACCTTTGCTGG - Intronic
1116268019 14:42720899-42720921 GCCCACAAAGACACTTTTGCAGG + Intergenic
1120887563 14:89463720-89463742 CTCCACAGCCAAACTTTTGGGGG - Intronic
1124974025 15:34516792-34516814 CCCCACAGAGACAGCTGTGCAGG + Intergenic
1126356645 15:47803036-47803058 CTACACTGAGACACTTGTCCCGG + Intergenic
1129223851 15:74153937-74153959 AGCCACAGAGACATTTTTGAAGG - Intergenic
1129480487 15:75821331-75821353 CCCCACAGAGACAGCTGTGCAGG - Intergenic
1130509002 15:84572839-84572861 CCCCACAGAGACAGCTGTGCAGG + Intergenic
1132227314 15:100152318-100152340 CCCCACACGGGCACTTTTGCAGG - Intronic
1145902331 17:28496984-28497006 CTTCCCAGAGAGAATTTTGCTGG + Intronic
1146599376 17:34201358-34201380 CTGCAGAGAGATACTTCTGCTGG + Intergenic
1148649822 17:49242147-49242169 CCACACAGAGACAGTTATGCAGG + Intergenic
1150508187 17:65720393-65720415 CTCCACAGGGAAACTGTTCCTGG - Intronic
1153175273 18:2365057-2365079 CTCCACAGTGTGCCTTTTGCTGG + Intergenic
1161518897 19:4712781-4712803 CTCCACAGACAGACTTGTGTGGG - Intronic
1163108085 19:15139071-15139093 TTCCACACAGCCACTTTTTCTGG - Intergenic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1163488156 19:17601735-17601757 CTCCAGAGAGCCACTATGGCTGG + Exonic
1164683067 19:30148921-30148943 CTCCTCAGACACACATGTGCAGG + Intergenic
925217632 2:2110932-2110954 CTCCACAGGGACAAGTTTGAAGG - Intronic
927889944 2:26741997-26742019 CTCCACTCGGAAACTTTTGCTGG - Intergenic
928438618 2:31272881-31272903 CTCCACAGAGAGAGTCTGGCGGG + Intergenic
929097828 2:38280706-38280728 CTCCACTGAGACACTCATTCTGG + Intergenic
931064473 2:58570078-58570100 GTCCACAGTCACACTTTTCCCGG + Intergenic
931715100 2:65022569-65022591 CTCCACAGAGTCCTTTCTGCTGG + Exonic
935210590 2:100936688-100936710 CTGCACCCAGCCACTTTTGCTGG - Intronic
944465177 2:199993586-199993608 TTCCACAGAGAGACTTATGGAGG - Intronic
944850043 2:203709615-203709637 ATCCACAGAGAGTATTTTGCTGG + Intronic
946251966 2:218419345-218419367 CTCCAGGGAGAGACTTTTGCAGG + Intronic
946419633 2:219557604-219557626 CTCCACAGAGCCCCCTGTGCGGG - Exonic
946428008 2:219609587-219609609 CTACACAGAGCCACTTTCCCTGG - Intronic
948710371 2:239821504-239821526 CTCCACAGACACTCCTGTGCTGG - Intergenic
1170858289 20:20077993-20078015 CTCCGAAGAGACAGTTTTGCAGG + Intronic
1172284068 20:33728700-33728722 CTCCACAGAGACAACTTGTCAGG + Intergenic
1173084541 20:39903365-39903387 CTCCAGGAAGAAACTTTTGCGGG - Intergenic
1180977171 22:19854808-19854830 CTCCACACTGACCCTCTTGCCGG + Exonic
1181069131 22:20321464-20321486 CTCCACACAGACACTCTTCATGG - Intergenic
1183253740 22:36747453-36747475 CTCCACAGAGAGGCTGCTGCTGG + Intergenic
1183295992 22:37029872-37029894 CTCCCCAGAGTGACCTTTGCTGG - Intergenic
1183979883 22:41533193-41533215 ACCCACAGAGGCATTTTTGCTGG - Intronic
949784577 3:7726208-7726230 CTCTTCAGAGACTATTTTGCAGG + Intronic
949905128 3:8852670-8852692 CTCTACAGAGACTCTTGTGGGGG + Intronic
952598278 3:35045239-35045261 TTCCAGAGAGAGATTTTTGCTGG + Intergenic
953946589 3:47153941-47153963 CTCCACAGAGTGAGTTTTTCTGG - Intronic
954534528 3:51349220-51349242 CTTCACAGAGAAGCTTTTCCTGG + Intronic
957259685 3:77884887-77884909 TTCCTCAGAGAGACTTTTGCTGG - Intergenic
958725376 3:97899149-97899171 CTCCACAGAAGAACTTTTGCTGG - Exonic
959089060 3:101882950-101882972 CTCCACACAGTCCTTTTTGCAGG - Intergenic
961148491 3:124615793-124615815 AACCACAGAGAGACTTTTGCGGG + Intronic
962418998 3:135210875-135210897 CTCTACAGAGAATCCTTTGCTGG - Intronic
964296467 3:155239642-155239664 CTCCACACTGACACTGCTGCTGG - Intergenic
964486197 3:157187148-157187170 CCCCAAAGAAGCACTTTTGCTGG + Intergenic
967933030 3:194704299-194704321 ATCGGCAGAGGCACTTTTGCAGG - Intergenic
968223573 3:196957720-196957742 CTCCAGAGTCACAGTTTTGCGGG + Intronic
969855803 4:9998655-9998677 CTCCCCAGAAACAGTTTTTCAGG - Intronic
970845169 4:20529004-20529026 CTTCACAGCGACACTTTTCAGGG - Exonic
971970392 4:33612243-33612265 CCCCACAAAGACAGCTTTGCAGG + Intergenic
973634578 4:52850219-52850241 CTCCACAGATTCAATTTTGAGGG + Intergenic
973931890 4:55801857-55801879 TTTCAGAGAGACAATTTTGCAGG - Intergenic
975167357 4:71192291-71192313 CTGCTCAGAGACTTTTTTGCTGG - Intronic
978408635 4:108405620-108405642 CCCCACAGAGACACTCTACCAGG - Intergenic
982923080 4:161301321-161301343 ATCCACAGAGACTCTTTTTATGG - Intergenic
983880356 4:172925309-172925331 CTACACAGAGAAACTTCTGAGGG + Intronic
984927430 4:184819049-184819071 CTCCTCAGAGGCACTTTTCCTGG - Intronic
985661704 5:1160523-1160545 CGCCACAGCGACACTGCTGCTGG + Intergenic
986371193 5:7081811-7081833 TTCCACAAAGACATTTTTGGAGG - Intergenic
986802330 5:11275052-11275074 CTCCATAGATAAACTTATGCAGG + Intronic
988560358 5:32275329-32275351 CTTGGCAGAGACACTTTTTCTGG - Intronic
994708357 5:103233752-103233774 CTCCTCAAAGACACTGCTGCTGG - Intergenic
996001822 5:118373556-118373578 CTACACTGGGACACTTTTGAGGG + Intergenic
996092845 5:119367453-119367475 TTACTCTGAGACACTTTTGCTGG - Intronic
997722271 5:136088694-136088716 CTCCACTCTCACACTTTTGCAGG - Intergenic
999152074 5:149432931-149432953 CTCCACACAGCCACTTTGGGAGG + Intergenic
1000207953 5:159080173-159080195 CTCCACAGAGAAATTTTGGCTGG + Intronic
1000368414 5:160511882-160511904 CCCCAGAGACACACGTTTGCAGG + Intergenic
1001888917 5:175322531-175322553 CTCCTCAGAGAGCCTTTTTCTGG - Intergenic
1003463228 6:6351907-6351929 ATCCACAGTCACAGTTTTGCTGG - Intergenic
1004444507 6:15685678-15685700 CTCCAAAGAGACACAGGTGCTGG + Intergenic
1004986599 6:21089560-21089582 CTCCTCAGAGAGAGCTTTGCTGG - Intronic
1008016145 6:46522017-46522039 CTAAAGAGAGACTCTTTTGCTGG + Intergenic
1011424737 6:87214061-87214083 ATCCAGAGACTCACTTTTGCAGG - Intronic
1013264003 6:108476000-108476022 CTCCACATACAAACTTTTACAGG - Intronic
1017499653 6:155011796-155011818 CTGCAAACAGACACTTTTTCAGG + Intronic
1022275407 7:28850031-28850053 GTCCTCACAGACACTTTTACAGG + Intergenic
1028368976 7:90069432-90069454 CCCCACAGAGACAGCTTTGCAGG + Intergenic
1029367247 7:100124582-100124604 CTTCACAGAGAAAATTTTGTAGG - Exonic
1032886727 7:136148322-136148344 CTGTACAGAGACATTTTTGGAGG - Intergenic
1034688844 7:152998016-152998038 CTCCAACGAGAAACTTGTGCAGG - Intergenic
1038084659 8:24181400-24181422 TTGCACAGAGGCACATTTGCAGG + Intergenic
1041843179 8:62295337-62295359 CTTCACTGAGGCATTTTTGCTGG - Intronic
1041970690 8:63738838-63738860 CTCCATAGCAAAACTTTTGCAGG - Intergenic
1045378443 8:101599445-101599467 CTGCACAGAGACGCCTTTGGGGG - Intronic
1045550190 8:103164459-103164481 CTCCAGAAAGACTCTTTGGCAGG - Intronic
1048447576 8:134503371-134503393 TTTCACAGAGACAATTTTGGTGG - Intronic
1049265589 8:141666262-141666284 CTCCTCAGAGACCCTGGTGCCGG + Intergenic
1049439935 8:142604692-142604714 CTCCCCATACACACATTTGCAGG - Intergenic
1049610497 8:143552856-143552878 CTTCACAGCTTCACTTTTGCTGG - Intergenic
1050207957 9:3217561-3217583 CTCTAAAGATACACTATTGCTGG - Intergenic
1050366010 9:4874480-4874502 CTCATCAGAGACACTTTGCCTGG - Intronic
1052221722 9:26032237-26032259 CCCCACAAAGACAACTTTGCAGG + Intergenic
1055429170 9:76226660-76226682 ATCCACAGAGCCACTTTTTCTGG - Intronic
1059576084 9:115490099-115490121 CTCCTTAGAGAGACTATTGCAGG + Intergenic
1061705434 9:132449641-132449663 TTCCAGACAGACACTTTTGTGGG + Intronic
1062280000 9:135747583-135747605 CCCCAAAGAGACACTTATGCAGG + Intronic
1062581147 9:137229815-137229837 CACCACACAGACCCTTTTGAGGG + Intergenic
1185791950 X:2933869-2933891 GGTCACAGAGACACCTTTGCTGG + Intergenic
1186010730 X:5129495-5129517 CTCAACAGAGAGAATTGTGCAGG + Intergenic
1188025325 X:25202310-25202332 CTGGACAAGGACACTTTTGCTGG + Intergenic
1188729284 X:33626724-33626746 CTCTAGGGAGACACTTTTACAGG - Intergenic
1191929583 X:66355875-66355897 CTCAACAGTGACACGTTTGAAGG - Intergenic
1192316215 X:70053720-70053742 CTCCACAGCGACGCTGTTGGAGG - Intergenic
1192657526 X:73007164-73007186 ATCCAAAGAGATACTTGTGCAGG - Intergenic
1196923029 X:120604020-120604042 CTCCACGTAGGCGCTTTTGCCGG - Intronic
1199716949 X:150513672-150513694 CCCCACAGAGACACTTTACCAGG + Intronic
1200702498 Y:6414065-6414087 CTGAAGAGTGACACTTTTGCAGG + Intergenic
1201031613 Y:9750633-9750655 CTGAAGAGTGACACTTTTGCAGG - Intergenic
1201281727 Y:12348418-12348440 GGTCACAGAGACACCTTTGCTGG - Intergenic
1201757748 Y:17505252-17505274 CTCCACATAGATATTTTTGTAGG + Intergenic
1201843806 Y:18400730-18400752 CTCCACATAGATATTTTTGTAGG - Intergenic