ID: 1091263544

View in Genome Browser
Species Human (GRCh38)
Location 11:134253178-134253200
Sequence CTCCACAGAGACACTTTTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091263539_1091263544 10 Left 1091263539 11:134253145-134253167 CCCTATCTCAGTATGTAGTTCAC 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG 0: 1
1: 1
2: 0
3: 7
4: 182
1091263538_1091263544 11 Left 1091263538 11:134253144-134253166 CCCCTATCTCAGTATGTAGTTCA 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG 0: 1
1: 1
2: 0
3: 7
4: 182
1091263540_1091263544 9 Left 1091263540 11:134253146-134253168 CCTATCTCAGTATGTAGTTCACT 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG 0: 1
1: 1
2: 0
3: 7
4: 182
1091263536_1091263544 27 Left 1091263536 11:134253128-134253150 CCTTCTCATCCAGGAACCCCTAT 0: 1
1: 0
2: 2
3: 32
4: 304
Right 1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG 0: 1
1: 1
2: 0
3: 7
4: 182
1091263537_1091263544 18 Left 1091263537 11:134253137-134253159 CCAGGAACCCCTATCTCAGTATG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG 0: 1
1: 1
2: 0
3: 7
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091263544 Original CRISPR CTCCACAGAGACACTTTTGT TGG Exonic
904013320 1:27402670-27402692 CTTCACAGAGACACGTGAGTGGG - Intergenic
904769647 1:32873650-32873672 CTCCACAGAGACCCCCTTGAGGG + Intergenic
905420721 1:37841628-37841650 CTGCACAGAGACTCTGGTGTGGG - Intronic
908358587 1:63345973-63345995 CTCCACAGAGCCACTCTAGGAGG + Intergenic
910458676 1:87425253-87425275 CTGCACAGAGGCACAATTGTGGG - Intergenic
911980922 1:104564888-104564910 CTTCAAAGAGACTCTCTTGTTGG - Intergenic
912011297 1:104966762-104966784 CTGGAGAGAGACACTTTTGCTGG - Intergenic
915719184 1:157971577-157971599 CCCCACAGAGAGACTTTACTAGG - Intergenic
916181918 1:162092467-162092489 CTTCAGAGAAACACTTTTCTTGG - Intronic
917265940 1:173220985-173221007 CTCCACAGAGAGGCCTTTGATGG - Intergenic
917737663 1:177935144-177935166 CTCCTCAGAGACACCTTCCTTGG + Intronic
918042998 1:180924496-180924518 CTCCACACAGATCCTTTTGAAGG + Intronic
919328545 1:196139387-196139409 CTCCACAGGGGGACTGTTGTAGG - Intergenic
919819565 1:201464630-201464652 CTCCAGAGAGACCCTGTAGTAGG + Intergenic
923461474 1:234213196-234213218 CTCCACAGAGCTACCCTTGTGGG + Intronic
923584822 1:235259073-235259095 CTCCACAGAAACAAATTTTTAGG + Intronic
924544827 1:245016593-245016615 CTCCATAGAGCTACTTTTATTGG - Intronic
1063066252 10:2612115-2612137 CTCTTCTGAGCCACTTTTGTGGG - Intergenic
1063555006 10:7070000-7070022 CACCACAGAGACATTTTAGAAGG + Intergenic
1065609751 10:27461277-27461299 CCCCACAAAGACAGCTTTGTGGG + Intergenic
1065769115 10:29060436-29060458 CTCCATAGAAACAATTTTATAGG + Intergenic
1067727251 10:48779550-48779572 CTCCACAGAGACTCCATTGTAGG - Intronic
1068203697 10:53818864-53818886 TTCTACAGAGATTCTTTTGTTGG - Intronic
1068865946 10:61896196-61896218 CTGCACAGAGAAATTTTAGTAGG + Intergenic
1069535127 10:69247619-69247641 CTCCAGGGAGACTCATTTGTGGG - Intronic
1074152726 10:110771983-110772005 CTCAACTGAGAAACTTTTCTTGG - Intronic
1080232772 11:30036130-30036152 TTCCACAGAAACATGTTTGTGGG + Intergenic
1082948848 11:58789032-58789054 CTTCACAGAGAAACTCTTCTAGG - Intergenic
1084038222 11:66526313-66526335 CTCCAGAAGGACACTTCTGTAGG - Intronic
1084098910 11:66932454-66932476 TTCCACAGAGACCCCTTGGTTGG + Intronic
1084608717 11:70187300-70187322 CTCCACGGAGACATTTCTGGTGG - Intronic
1091263239 11:134250482-134250504 CTCCACAGAGACACTTTTGCTGG + Intronic
1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG + Exonic
1091328874 11:134714656-134714678 CTCCACAGAGCAACTTATTTTGG - Intergenic
1092006260 12:5073014-5073036 CTCCACAGCAACACTAATGTGGG + Intergenic
1094404453 12:30100439-30100461 CTGCACAGGGAAACTTTTGGAGG - Intergenic
1094812661 12:34154280-34154302 CTCCACATGGATATTTTTGTAGG + Intergenic
1097259800 12:57712047-57712069 AACCACAGATACACCTTTGTAGG - Intronic
1101301684 12:103489550-103489572 CTCCATAGAGGCACTTCTTTGGG - Intronic
1102579017 12:113874247-113874269 CTCCACAGACACTTTTTAGTGGG - Intronic
1102760068 12:115377230-115377252 CTTCACAGGGACACATATGTTGG + Intergenic
1107735235 13:43392120-43392142 CTCCACAAAGACACTGTTCGTGG + Intronic
1107966716 13:45604025-45604047 CTCCCCAGATGCACTGTTGTGGG + Intronic
1109007212 13:56893551-56893573 CTCTACAGAGGCCTTTTTGTGGG + Intergenic
1109440499 13:62365277-62365299 CTACACAGTGAGTCTTTTGTTGG - Intergenic
1109471266 13:62807631-62807653 CATCAAAGAGACACTTTTTTTGG - Intergenic
1110425794 13:75364823-75364845 CTCTGTAGAGACACTTTTGGAGG - Intronic
1111302668 13:86365843-86365865 CTCCACAGAGAAACTCTACTAGG + Intergenic
1111578853 13:90196306-90196328 CTCCAGAGAAACACTTGTGAAGG - Intergenic
1116268019 14:42720899-42720921 GCCCACAAAGACACTTTTGCAGG + Intergenic
1120887563 14:89463720-89463742 CTCCACAGCCAAACTTTTGGGGG - Intronic
1121723844 14:96131649-96131671 CCCCACACAAACACTTTTTTAGG + Intergenic
1128740110 15:70077920-70077942 CTCCACATTGACACATGTGTGGG + Intronic
1128935804 15:71745606-71745628 CTCTCCCGAGACACTTTTCTTGG - Intronic
1129223851 15:74153937-74153959 AGCCACAGAGACATTTTTGAAGG - Intergenic
1129268530 15:74407673-74407695 CTCCACAGAGACAATGGAGTGGG + Intergenic
1131969166 15:97875156-97875178 GGCCACAAAGCCACTTTTGTTGG - Intergenic
1133321996 16:4919942-4919964 CCCCACAAATACACTTTTTTTGG - Intronic
1139601395 16:67989612-67989634 ATCCACAGAGCCACTTGTCTGGG + Intronic
1144112354 17:12048200-12048222 CTCCACAAAGACTGTTTCGTTGG - Intronic
1144784076 17:17822328-17822350 CTACACAGAGACACACTGGTTGG - Intronic
1145726735 17:27134527-27134549 CTGCACAGATATCCTTTTGTAGG - Intergenic
1145903103 17:28500512-28500534 CTCCACGTACACACATTTGTGGG - Intronic
1147346547 17:39800663-39800685 CACCCCAGAGAGAATTTTGTAGG + Intronic
1147867212 17:43560877-43560899 CTGCACAGAGACGATTCTGTTGG - Intronic
1149229880 17:54520430-54520452 CTCCACATAGACAATGATGTTGG + Intergenic
1151730863 17:75910362-75910384 CTCCACAGGTAGACTGTTGTGGG - Intronic
1152320622 17:79607199-79607221 TTCAACAGAGACCCGTTTGTTGG - Intergenic
1154047905 18:10924637-10924659 CTCAAAAGAGAAATTTTTGTTGG - Intronic
1156191582 18:34726904-34726926 CTCCACAAAGATACTTTCCTAGG - Intronic
1156471018 18:37377309-37377331 CTCCACTGAGGCAGTTTTTTGGG - Intronic
1158887909 18:61846272-61846294 CTCCCCAAAGACAGTTTTTTGGG - Intronic
1160071582 18:75633655-75633677 TTCCAGAGAGTCACTTTCGTAGG + Intergenic
1160188738 18:76697218-76697240 CTCCAAGGACACTCTTTTGTTGG - Intergenic
1161518897 19:4712781-4712803 CTCCACAGACAGACTTGTGTGGG - Intronic
1162674086 19:12285130-12285152 CTGCACAGAGACTCTGGTGTGGG - Intronic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1165294559 19:34916263-34916285 CTGCACAGAGCCACTTTCCTGGG - Intergenic
1165747949 19:38241656-38241678 CTACATAGGGACACTTTAGTAGG + Intergenic
1166391670 19:42412027-42412049 GTCCACAGCCACACTTATGTGGG + Intronic
1168419253 19:56190523-56190545 TTCCACAGAGGCTCTTTTCTGGG + Exonic
1168421738 19:56208482-56208504 TTCCACAGAGGCTCTTTTTTGGG - Exonic
925217632 2:2110932-2110954 CTCCACAGGGACAAGTTTGAAGG - Intronic
928422811 2:31152531-31152553 CTCCAAAGGAACTCTTTTGTAGG - Intronic
930228595 2:48820599-48820621 CTCTAGAGATACATTTTTGTGGG - Intergenic
932066089 2:68562385-68562407 CTGGAGAGAGATACTTTTGTAGG + Intronic
932810899 2:74825224-74825246 CTTAATAGAGACTCTTTTGTGGG + Intergenic
933662561 2:84939627-84939649 CTCCAGAGAGGAAATTTTGTTGG - Intergenic
938933468 2:136108019-136108041 GTCCACAGATACAATTTTATTGG + Intergenic
941459049 2:165745493-165745515 CTTCACAGATATTCTTTTGTAGG + Intergenic
942026329 2:171914104-171914126 CTCTAAAGAGACAATTTTCTGGG - Intronic
943105514 2:183542344-183542366 TTACACAGATACACTTTTATAGG - Intergenic
943308689 2:186299654-186299676 CACCACAGAGTTATTTTTGTGGG + Intergenic
944465177 2:199993586-199993608 TTCCACAGAGAGACTTATGGAGG - Intronic
946251966 2:218419345-218419367 CTCCAGGGAGAGACTTTTGCAGG + Intronic
1170858289 20:20077993-20078015 CTCCGAAGAGACAGTTTTGCAGG + Intronic
1171344331 20:24454037-24454059 CTCCACAGAGTCCCTCTTCTTGG - Intergenic
1171424667 20:25042091-25042113 GTCCACAGAGACCTCTTTGTTGG - Intronic
1175001845 20:55637582-55637604 TACCACACAGACACTTTTATAGG + Intergenic
1176255235 20:64148485-64148507 CCCCACAGAGAAACTCTTCTTGG - Intergenic
1176688209 21:9873669-9873691 CTCCAATGAAGCACTTTTGTTGG + Intergenic
1178218239 21:30625337-30625359 CCCCACAGAGAAACTCTAGTAGG - Intergenic
1179204189 21:39258848-39258870 CTCTACAGGAAGACTTTTGTTGG - Intronic
1181069131 22:20321464-20321486 CTCCACACAGACACTCTTCATGG - Intergenic
1181367566 22:22389963-22389985 CTCCACAGATGCAATATTGTGGG + Intergenic
1184458092 22:44622724-44622746 CTGCACAGAGACAGGTTTCTGGG + Intergenic
1184755761 22:46514957-46514979 TTGGACAGAGCCACTTTTGTGGG - Intronic
949905128 3:8852670-8852692 CTCTACAGAGACTCTTGTGGGGG + Intronic
954439493 3:50513974-50513996 CTCCCCAGAGATACCTTGGTGGG - Intergenic
956484991 3:69712552-69712574 CTTCAAAGAGAGACATTTGTAGG + Intergenic
956884170 3:73542369-73542391 ATCCACTGAGACAATGTTGTTGG - Intronic
957259685 3:77884887-77884909 TTCCTCAGAGAGACTTTTGCTGG - Intergenic
958725376 3:97899149-97899171 CTCCACAGAAGAACTTTTGCTGG - Exonic
961148491 3:124615793-124615815 AACCACAGAGAGACTTTTGCGGG + Intronic
965168915 3:165234987-165235009 CTCTCTAGAGACATTTTTGTTGG - Intergenic
965297705 3:166970515-166970537 ATCTGCAGAGACACATTTGTTGG - Intergenic
966607915 3:181840270-181840292 GACCACAGTGACACTTTGGTGGG + Intergenic
967487089 3:190045604-190045626 CTCCAAAGAAACACTTATATTGG - Intronic
968095182 3:195924779-195924801 ATGCACAAAGAAACTTTTGTAGG - Intergenic
968719920 4:2194388-2194410 TTCCACAGAAAGACATTTGTAGG + Intronic
969272026 4:6109478-6109500 CTTCACAGGGGCAGTTTTGTGGG - Intronic
970845169 4:20529004-20529026 CTTCACAGCGACACTTTTCAGGG - Exonic
973089800 4:46121571-46121593 TGACACAGAAACACTTTTGTAGG - Intronic
973544219 4:51964333-51964355 TTTGACAGAGGCACTTTTGTAGG + Intergenic
973634578 4:52850219-52850241 CTCCACAGATTCAATTTTGAGGG + Intergenic
974043634 4:56879082-56879104 CACCACAGACACACTTTGCTTGG - Intergenic
974702323 4:65467642-65467664 TTCCACAGAGCCATTGTTGTAGG + Intronic
974929732 4:68348899-68348921 CTCCAGAGAGACACTGATCTAGG + Intronic
979151812 4:117326432-117326454 CTCCCCAGGGACACCTATGTTGG + Intergenic
980337095 4:131489891-131489913 CTCCACTGATACACCTTGGTTGG + Intergenic
980365158 4:131794096-131794118 CCCCACAGAAACAGCTTTGTAGG - Intergenic
980686697 4:136239339-136239361 CTACACAGAAACACTTTCATAGG + Intergenic
982047086 4:151458818-151458840 CACCACAGAGTCGCTTTTCTTGG + Intronic
982923080 4:161301321-161301343 ATCCACAGAGACTCTTTTTATGG - Intergenic
983880356 4:172925309-172925331 CTACACAGAGAAACTTCTGAGGG + Intronic
984927430 4:184819049-184819071 CTCCTCAGAGGCACTTTTCCTGG - Intronic
984930400 4:184842090-184842112 TTCCACAGAGACACCACTGTGGG - Intergenic
986371193 5:7081811-7081833 TTCCACAAAGACATTTTTGGAGG - Intergenic
987480789 5:18454717-18454739 CTCCATAGAATCAATTTTGTAGG + Intergenic
987724892 5:21685293-21685315 CTAAACAGAGACACCTTTATTGG + Intergenic
992778405 5:80107430-80107452 CTCCCCAAAGCCACTGTTGTGGG - Intergenic
994173574 5:96685151-96685173 CTCTTCAGAGACAATTTGGTGGG - Intronic
996001822 5:118373556-118373578 CTACACTGGGACACTTTTGAGGG + Intergenic
998378867 5:141709774-141709796 CTTCACATTGACACTTTTCTGGG - Intergenic
999152074 5:149432931-149432953 CTCCACACAGCCACTTTGGGAGG + Intergenic
999661846 5:153872610-153872632 CGTGGCAGAGACACTTTTGTTGG - Intergenic
1000207953 5:159080173-159080195 CTCCACAGAGAAATTTTGGCTGG + Intronic
1001403174 5:171458518-171458540 CCCCACAAAGACACTTAGGTTGG - Intergenic
1002116795 5:176968584-176968606 CTTGAAAGAGAAACTTTTGTTGG - Exonic
1005367491 6:25093817-25093839 GACCACTGAGGCACTTTTGTGGG - Intergenic
1007669333 6:43538855-43538877 CTGCACAGAGACTCTGGTGTGGG + Intronic
1008106809 6:47447911-47447933 CTCCACATAGACACAAATGTTGG - Intergenic
1008504274 6:52214186-52214208 AACTACAGAGACACCTTTGTAGG + Intergenic
1012368088 6:98467408-98467430 CTTCACAGAGAAGCTCTTGTAGG - Intergenic
1014261084 6:119217926-119217948 CTCATCACAGACACTTTTCTAGG + Intronic
1018208462 6:161457232-161457254 CTTAACAGAGACACATGTGTAGG - Intronic
1020274678 7:6616882-6616904 CCCCACAGAGACACAACTGTGGG - Intronic
1021048651 7:15955134-15955156 GTCCACAGAGACTCTGTAGTGGG + Intergenic
1024347129 7:48324481-48324503 TTCCAAAGAGGCACTGTTGTGGG - Intronic
1028368976 7:90069432-90069454 CCCCACAGAGACAGCTTTGCAGG + Intergenic
1029367247 7:100124582-100124604 CTTCACAGAGAAAATTTTGTAGG - Exonic
1030750588 7:113227267-113227289 CCCCACAGAGAAACTTTACTAGG + Intergenic
1031558247 7:123205129-123205151 CTCCAAAGAGACAATATTTTTGG - Intergenic
1032886727 7:136148322-136148344 CTGTACAGAGACATTTTTGGAGG - Intergenic
1033844038 7:145410950-145410972 CCCCACAAAGACAGCTTTGTAGG + Intergenic
1038247107 8:25868911-25868933 CTCCACTTATACATTTTTGTTGG + Intronic
1038968267 8:32601351-32601373 CTGCACAGAGATATTCTTGTAGG + Intronic
1039445704 8:37630308-37630330 GGCCACAGAGCCACTTTGGTGGG + Intergenic
1043514731 8:80985644-80985666 CTCCAATGAGAGACTCTTGTAGG + Intronic
1045378443 8:101599445-101599467 CTGCACAGAGACGCCTTTGGGGG - Intronic
1047258932 8:123238830-123238852 CCCCAAAGAGATCCTTTTGTTGG + Intronic
1048447576 8:134503371-134503393 TTTCACAGAGACAATTTTGGTGG - Intronic
1051383713 9:16484444-16484466 CTTCACTGAGACACCATTGTTGG + Intronic
1054169078 9:61818357-61818379 CTCCAATGAAGCACTTTTGTTGG - Intergenic
1054668454 9:67762459-67762481 CTCCAATGAAGCACTTTTGTTGG + Intergenic
1055429170 9:76226660-76226682 ATCCACAGAGCCACTTTTTCTGG - Intronic
1056772899 9:89492524-89492546 CTCCACTGGGACACTTCAGTAGG + Intronic
1061705434 9:132449641-132449663 TTCCAGACAGACACTTTTGTGGG + Intronic
1062280000 9:135747583-135747605 CCCCAAAGAGACACTTATGCAGG + Intronic
1062581147 9:137229815-137229837 CACCACACAGACCCTTTTGAGGG + Intergenic
1186742849 X:12535967-12535989 CAAGACAGAGAGACTTTTGTGGG + Intronic
1191929583 X:66355875-66355897 CTCAACAGTGACACGTTTGAAGG - Intergenic
1192316215 X:70053720-70053742 CTCCACAGCGACGCTGTTGGAGG - Intergenic
1192872123 X:75194743-75194765 CCCTACACAAACACTTTTGTTGG - Intergenic
1193148456 X:78101527-78101549 CTCTAGAGAGACACCCTTGTTGG - Intronic
1194247093 X:91528711-91528733 CTCATTAGAGACACTCTTGTTGG - Intergenic
1199716949 X:150513672-150513694 CCCCACAGAGACACTTTACCAGG + Intronic
1200566115 Y:4770249-4770271 CTCATTAGAGACACTCTTGTTGG - Intergenic
1201514684 Y:14806470-14806492 CTCCACACACAAACTTTTATAGG - Intronic
1201757748 Y:17505252-17505274 CTCCACATAGATATTTTTGTAGG + Intergenic
1201843806 Y:18400730-18400752 CTCCACATAGATATTTTTGTAGG - Intergenic