ID: 1091263669

View in Genome Browser
Species Human (GRCh38)
Location 11:134253804-134253826
Sequence CGGAAGGGGAGCTGACGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091263669_1091263678 -1 Left 1091263669 11:134253804-134253826 CCCCGGCGTCAGCTCCCCTTCCG 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1091263678 11:134253826-134253848 GGCCAGTCACCCCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 228
1091263669_1091263687 16 Left 1091263669 11:134253804-134253826 CCCCGGCGTCAGCTCCCCTTCCG 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1091263687 11:134253843-134253865 GCCTGGCTCCCTACTCCGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 153
1091263669_1091263685 12 Left 1091263669 11:134253804-134253826 CCCCGGCGTCAGCTCCCCTTCCG 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1091263685 11:134253839-134253861 CCCGGCCTGGCTCCCTACTCCGG 0: 1
1: 0
2: 1
3: 23
4: 267
1091263669_1091263691 26 Left 1091263669 11:134253804-134253826 CCCCGGCGTCAGCTCCCCTTCCG 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263669_1091263676 -6 Left 1091263669 11:134253804-134253826 CCCCGGCGTCAGCTCCCCTTCCG 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1091263676 11:134253821-134253843 CTTCCGGCCAGTCACCCCCCCGG 0: 1
1: 0
2: 1
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091263669 Original CRISPR CGGAAGGGGAGCTGACGCCG GGG (reversed) Intronic
900227520 1:1540104-1540126 GGGGAGGGGAGCGGAGGCCGGGG + Intronic
900284075 1:1890959-1890981 CGGGAGTGGAGCAGCCGCCGCGG - Exonic
900324487 1:2101627-2101649 AGGAAGGGGAACTGAAGCCCAGG - Intronic
900409677 1:2506992-2507014 CAAGAGGGGAGCTGAGGCCGTGG + Intergenic
900578658 1:3396647-3396669 CGGAAGAGGAGCAGATGCCTGGG + Intronic
900663206 1:3796342-3796364 CGGGTGGGCAGCTGCCGCCGCGG - Exonic
901154387 1:7125660-7125682 AGGAAGGAGAGCTGGCCCCGGGG + Intronic
908601416 1:65744175-65744197 CGGAAAGGGGGCTGAAGCCAGGG - Intergenic
909690152 1:78398202-78398224 CGGAAAGGGGGCTGAAGCCAGGG - Intronic
910002822 1:82358888-82358910 CGGTGGGGGAGCAGACGCTGAGG + Intergenic
914862734 1:151399839-151399861 CGGCAGGGGAGCTCAGGGCGCGG + Intronic
915740270 1:158113724-158113746 CGGGAGGAGCGCTGACTCCGCGG + Intergenic
915876506 1:159616539-159616561 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
917111904 1:171557409-171557431 CGGAAGTGGAGCTGAGGTTGAGG - Exonic
917357745 1:174144035-174144057 TGGAAAGGGGGCTGAAGCCGGGG + Intergenic
921312037 1:213854136-213854158 AGGTAGGGGAGCTGTCCCCGAGG - Intergenic
921401403 1:214727623-214727645 TGGAAGGGGGGCTGAAGCCAGGG - Intergenic
921626165 1:217379831-217379853 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
1064662063 10:17616943-17616965 GGGGAAGGGAGCTGTCGCCGCGG - Intronic
1067844353 10:49708087-49708109 GGGAAGTGGAGCTGAAGCTGTGG - Intronic
1069784261 10:70977790-70977812 CAGATGGGGACCTGAGGCCGGGG - Intergenic
1070327079 10:75396293-75396315 AGGAAACGGAGCTGGCGCCGAGG - Intergenic
1070632457 10:78096535-78096557 CGGAAAGGGGGCTGAAGCCAGGG + Intergenic
1070912802 10:80132846-80132868 CGGCAGGGGACCTGGAGCCGGGG + Intronic
1076864238 10:133159570-133159592 CGGACGGGGAGCTGACAGCCGGG + Intergenic
1079316509 11:19412088-19412110 TGGAAAGGGAGCTGAAGCCAGGG + Intronic
1080386188 11:31812449-31812471 CTGAAGGGGAGCTGCCTCCGTGG - Intronic
1081486824 11:43537427-43537449 AGGACGTGGAGCTGCCGCCGAGG - Intergenic
1085433839 11:76481410-76481432 TGGAAAGGGAGCTGAAGCCAGGG + Intronic
1087667773 11:101070489-101070511 TGGAAGGGGGGCTGAAGCCAGGG + Intronic
1089977454 11:122744944-122744966 GGGAAGGGCAGCTGAGGCAGAGG + Intronic
1091263669 11:134253804-134253826 CGGAAGGGGAGCTGACGCCGGGG - Intronic
1093402286 12:18761118-18761140 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
1093714480 12:22366102-22366124 TGGAAAGGGAGCTGAAGCCAGGG + Intronic
1095356405 12:41280379-41280401 TGGAAAGGGAGCTGAAGCCAGGG + Intronic
1097496929 12:60351618-60351640 AGGAAAGGGAGCTAACGACGTGG - Intergenic
1099228237 12:79993723-79993745 CAGAATGGGCGCTGAGGCCGAGG + Intergenic
1101947736 12:109150643-109150665 AGGAAAGGGAGCTGACACCAGGG + Intronic
1104686764 12:130790849-130790871 CGGAAACGGAGCTGAGGCCGAGG + Exonic
1104785883 12:131447715-131447737 CAGACGGGGCGCTGAGGCCGAGG - Intergenic
1105605227 13:21921144-21921166 CAGAATGGGTGCCGACGCCGAGG + Intergenic
1106463967 13:29996329-29996351 CAGAAGGGAAGCTCACGCCTGGG - Intergenic
1108235027 13:48394417-48394439 CGGAAAGGGGGCTGAAGCCAGGG + Intronic
1108261506 13:48661268-48661290 CTGATAAGGAGCTGACGCCGAGG + Intronic
1108998299 13:56763308-56763330 CGGAAAGGGTGCTGAAGCCAGGG + Intergenic
1109007675 13:56900575-56900597 CAGAATGGGTGCTGAGGCCGAGG - Intergenic
1109271270 13:60258438-60258460 CGGAAAGGGGGCTAAAGCCGGGG + Intergenic
1115268700 14:31527573-31527595 CAGAGTGGGCGCTGACGCCGAGG + Intronic
1118875926 14:69784877-69784899 GGGAAGGGGAGCTGTGGCCATGG + Intronic
1123023068 14:105411315-105411337 GCGAAGGGGAGCTGGCGCCGAGG + Intronic
1128309573 15:66621957-66621979 CAGACGGGGAGTTGACGCCCTGG - Intronic
1130397484 15:83515541-83515563 GGGAATGGGAGCTGATGCCTAGG + Intronic
1132519871 16:382044-382066 CGGGGGGGGCGCGGACGCCGGGG + Intronic
1136620075 16:31422806-31422828 AGGGAGGGGAGCTGAAGCCGAGG + Intronic
1137587059 16:49669983-49670005 AGGAAGGGGAGGAGACGCCAAGG + Intronic
1139481312 16:67232228-67232250 AGGAAGGGGGCCTGACGCGGTGG + Intronic
1140758835 16:78092786-78092808 CAGAAGAGGAGCTGACGGCAAGG + Intergenic
1142090406 16:88206867-88206889 CGGAGGGGGAGGGGAGGCCGCGG + Intergenic
1142090419 16:88206893-88206915 CGGAGGGGGAGGGGAGGCCGCGG + Intergenic
1142090491 16:88207043-88207065 CGGAGGGGGAGGGGAGGCCGCGG + Intergenic
1142090516 16:88207094-88207116 CGGAGGGGGAGGGGAGGCCGTGG + Intergenic
1145990627 17:29077399-29077421 GGGGAGGGGAGCTGCCGCCCTGG - Exonic
1149281297 17:55108383-55108405 TGGAAAGGGAGCTGAAGCCAGGG - Intronic
1150006227 17:61470630-61470652 CGGGACTGGAGCTGACGCCCAGG - Intronic
1151653829 17:75486207-75486229 GGGAAGGGGAGCTGTGGCCTGGG + Intronic
1151662176 17:75525064-75525086 CGGAAAGGGCGCGGAGGCCGGGG - Intronic
1152625596 17:81386743-81386765 CGGCAGGGAAGGTCACGCCGGGG - Intergenic
1152792830 17:82291414-82291436 CAGAAGAGCAGCTGACGCAGGGG - Intergenic
1153617473 18:6947896-6947918 TGCAAGGGGAGCTGAGGCCATGG + Intronic
1155450411 18:25957504-25957526 AGGAAGGGGAGCTGATCCCAGGG - Intergenic
1155932806 18:31724513-31724535 CTGAAGCGGAGCTGACGTCTGGG - Intergenic
1156415151 18:36880005-36880027 TGGAAAGGGAGCTGAAGCCTGGG - Intronic
1157071728 18:44416386-44416408 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
1160289003 18:77572803-77572825 GCCAAGGGGAACTGACGCCGGGG + Intergenic
1160812023 19:1017066-1017088 CTGAAGGGGAGCTGAGGCTTTGG - Intronic
1160820605 19:1056024-1056046 GGGAAGGGGAGCTGAGGGCCGGG - Intronic
1165313096 19:35040257-35040279 CGGGAGGGGAAATGATGCCGGGG - Intronic
1165585928 19:36915897-36915919 CCGATGGGGAGCTGGCGCCTTGG - Exonic
1165685717 19:37817879-37817901 GGGAAGGGTTGCTGACGCCACGG - Intergenic
924967599 2:92471-92493 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
927216348 2:20669771-20669793 CCGAAGGGGAACTGAGGCCCAGG - Intronic
928341578 2:30447457-30447479 AGGAAGGGGAGCTGCAGCCCGGG + Intronic
931004077 2:57828120-57828142 CGGAAAGGGAGCTGAAGCCAGGG + Intergenic
934566495 2:95344393-95344415 TGGATGGGGAGCTGACTCCCAGG - Intronic
934780453 2:96966483-96966505 CGGAAGGAAAGCTGAAGCAGTGG + Intronic
936025375 2:109027573-109027595 CAGGAGGGGAGCTGAGGCCCAGG - Intergenic
937268829 2:120634132-120634154 GGGAAGGGGAGCTGCCGAGGGGG - Intergenic
940400692 2:153244794-153244816 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
942953712 2:181750514-181750536 CGGAAAGGGGGCTGACACCAGGG - Intergenic
943074664 2:183179527-183179549 CGGAAAGGGGGCTGAAGCCAAGG - Intergenic
943105685 2:183543709-183543731 TGGAAGGGGGGCTGAAGCCAGGG + Intergenic
944221723 2:197310403-197310425 GCGGAGGGGAGCTGCCGCCGCGG + Intronic
944287793 2:197971530-197971552 CGGCAGGGGAGGTGACACAGGGG + Intronic
947885450 2:233566164-233566186 GGGAAGGGGAGCGGAGGGCGGGG + Intronic
948963278 2:241356480-241356502 CGGGGGGGGCGCTGAGGCCGCGG + Intronic
1172781393 20:37438739-37438761 AGGAAGGGGAGCAGAAGCCTGGG - Intergenic
1176056997 20:63154351-63154373 CGGGAGGGCACCTGAGGCCGAGG - Intergenic
1180252321 21:46597634-46597656 CGGGAGGGGCGCTGCTGCCGGGG - Intergenic
1181560635 22:23697659-23697681 GGGAATGGGAGCTGAGGCCCAGG - Intronic
1183021511 22:35030920-35030942 TGGAAAGGGAGCTGAAGCCAGGG - Intergenic
1183601733 22:38843987-38844009 CGGAGCTGGAGCTGTCGCCGCGG + Intergenic
1185258159 22:49848214-49848236 CGGGAGGGAAGCTCAGGCCGGGG - Intergenic
1185258618 22:49849616-49849638 AGGAAGGAGCCCTGACGCCGCGG - Intergenic
956220065 3:66893191-66893213 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
956383081 3:68686431-68686453 CGGAAAGGGGGCTGAAGCCAAGG - Intergenic
961734697 3:128994018-128994040 CGGTACGGGAGTTGCCGCCGCGG - Exonic
962064364 3:131963405-131963427 TGGAAAGGGAGCTGAAGCCAGGG + Intronic
962383841 3:134916847-134916869 CAGAATGGGTGCTGAGGCCGAGG + Intronic
962668375 3:137679510-137679532 CGGAAAGGGGGCTGAAGCCAGGG + Intergenic
963939595 3:151085964-151085986 GGGAAGAGGAGCTGGGGCCGTGG + Intronic
964445276 3:156751614-156751636 CTGGAGGGGAGCCGTCGCCGCGG + Intergenic
965655061 3:170975253-170975275 AGGAAGGGGTGCTGAAGCCAGGG - Intergenic
977438986 4:97038071-97038093 TGGAAAGGGAGCTGAAGCCAGGG - Intergenic
977723502 4:100267748-100267770 TGGAAAGGGAGCTGAAGCCAGGG - Intergenic
978139051 4:105297110-105297132 CGGAAAGGGAGCTGAAACCAGGG + Intergenic
978939720 4:114421736-114421758 CTTAAGGGGAGCTGAGGCTGGGG - Intergenic
979421374 4:120509273-120509295 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
980774418 4:137420892-137420914 CAGAATGGGTGCTGAGGCCGAGG - Intergenic
983596330 4:169472087-169472109 TGGAAAGGGAGCTGAAGCCAGGG - Intronic
985667000 5:1186533-1186555 CGGAGGTGGAGCTGACCCTGCGG + Intergenic
985779814 5:1864549-1864571 AGGAGAGGGAGCTGTCGCCGTGG - Intergenic
994107237 5:95961410-95961432 GGGCAGGGTGGCTGACGCCGCGG - Intronic
994233553 5:97336364-97336386 TGGAAAGGGGGCTGACGCCAGGG - Intergenic
997239326 5:132295055-132295077 CTCAAGGGGGGCTGACGCAGAGG - Intronic
997252268 5:132398291-132398313 CGGAAAGGGGGCTGAAGCCAGGG + Intergenic
998511560 5:142718500-142718522 GGGAATGGGAGATGAAGCCGGGG - Intergenic
1001482798 5:172100129-172100151 CGGCAGAGGAGCTGATGCCGTGG - Intronic
1002399506 5:178983710-178983732 AGGAATGGGAGCTGATGCCGAGG + Intronic
1003224542 6:4191775-4191797 CAGAATGGGCGCTGAGGCCGAGG + Intergenic
1004220542 6:13743078-13743100 CAGAATGGGCGCTGAGGCCGAGG - Intergenic
1004234149 6:13859868-13859890 CAGAATGGGCGCTGAGGCCGAGG - Intergenic
1004516532 6:16326604-16326626 CGTAGGGGGAGCCGCCGCCGGGG + Exonic
1006814250 6:36839815-36839837 CGGATGGGGCGCTGGCGGCGGGG + Exonic
1007614572 6:43172321-43172343 CCGAAGGGGAGGGGCCGCCGGGG + Intronic
1008785094 6:55158470-55158492 TGGAAAGGGAGCTGAAGCCAGGG + Intronic
1010229441 6:73521624-73521646 CGGGAGGGGCGCGGAAGCCGGGG - Intronic
1011332769 6:86228341-86228363 TGGAAAGGGAGCTGAAGCCAGGG - Intergenic
1013964192 6:115935513-115935535 TGGAAGGGGGGCTGAAGCCAGGG + Exonic
1014278823 6:119418107-119418129 CGGAAAGGGGGCTGAAGCCAGGG + Intergenic
1017000626 6:149995096-149995118 CAGAAGGGGAGCTGGCGTGGAGG - Intergenic
1017842506 6:158232775-158232797 CGGCAGGGGAGGTGGCGGCGCGG - Intronic
1018368785 6:163149159-163149181 CAGAAGGGGAGGTGACAGCGAGG - Intronic
1020125299 7:5530000-5530022 CGGAAGGGGTGGGGTCGCCGCGG - Intronic
1020629729 7:10625532-10625554 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
1020935473 7:14458867-14458889 TGGAAAGGGAGCTGAAGCCAGGG + Intronic
1021014642 7:15517836-15517858 TGGAAAGGGAGCTGAAGCCAGGG + Intronic
1024471989 7:49774656-49774678 CGGCAGAGGAGCTGAAGCCCCGG + Intronic
1026833354 7:73623237-73623259 CAGAAGGGGAGGAGGCGCCGCGG + Intronic
1026846059 7:73699805-73699827 GGGAAGGGAAGCTGAGGCCCAGG + Exonic
1028998383 7:97126771-97126793 TGGAAAGGGAGCTGAAGCCAGGG - Intronic
1029351403 7:100015669-100015691 AGAAAGGGGAGCTGACTCTGGGG - Exonic
1029851129 7:103462721-103462743 TGGAAAGGGAGCTGAAGCCAGGG - Intergenic
1029892082 7:103941061-103941083 GGGAAGGGGAGGTGACCCAGGGG - Intronic
1030325865 7:108217894-108217916 TGGAAAGGGAGCTGAAGCCAGGG - Intronic
1030958835 7:115889314-115889336 CGGAAAGGGGGCTGAAGCCAGGG + Intergenic
1032716452 7:134512951-134512973 GGGAAGGGGTGCTGACATCGCGG + Intergenic
1033680028 7:143584561-143584583 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
1033691806 7:143744881-143744903 TGGAAAGGGAGCTGAAGCCAGGG - Intergenic
1034582117 7:152053230-152053252 AGGAAGGGGATCTGATGCTGAGG - Intronic
1035375542 7:158404754-158404776 GGGCCGGGGAGCTGAGGCCGGGG - Intronic
1035375599 7:158404887-158404909 GGGCCGGGGAGCTGAGGCCGAGG - Intronic
1035375638 7:158405003-158405025 GGGCCGGGGAGCTGAGGCCGAGG - Intronic
1035375669 7:158405076-158405098 GGGCCGGGGAGCTGAGGCCGAGG - Intronic
1035571899 8:677939-677961 AGGAGGGGAAGCTGACCCCGGGG - Intronic
1037903995 8:22704738-22704760 GGGAAGAGGGGCTGATGCCGGGG - Intergenic
1039212695 8:35235354-35235376 CGGGAGGGGCGGTGACGCGGCGG - Intergenic
1040039132 8:42897879-42897901 CGGCAGGGGAACCGACGCCCGGG + Intronic
1040943066 8:52852634-52852656 CTGAAGGGGGGCTGAAGCCAGGG - Intergenic
1043413964 8:80029926-80029948 AGGAAGGGGAGCTGAGGTCCGGG - Intronic
1045336061 8:101205401-101205423 CGGGGGCGGTGCTGACGCCGCGG - Intronic
1045638651 8:104223250-104223272 CGGAGGGGGAGGTGGCGGCGCGG - Intronic
1046219920 8:111200825-111200847 TGGAAGGGGGGCTGAAGCCAGGG + Intergenic
1053250824 9:36572833-36572855 CGGAAGGGGCGGGGACGCGGCGG - Intergenic
1054884935 9:70185855-70185877 TGGAAAGGGAGCTGAAGCCAGGG - Intronic
1055210298 9:73783199-73783221 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
1056992431 9:91423997-91424019 CGGAGGGGGAGCTGAGGGCGGGG - Intergenic
1057311505 9:93946057-93946079 TGGAAGCGGAGCTGCCGCGGGGG + Intergenic
1057505045 9:95626863-95626885 GGGAAGGGGAGCTGGCTCCAGGG - Intergenic
1062030666 9:134360532-134360554 CGGAAGGGGCGCTGGCACGGCGG - Intronic
1062099687 9:134721619-134721641 CGGAGGAGGAGCTGAAGCAGAGG - Intronic
1186397293 X:9222780-9222802 CAGAAGGGAAGCTGAGGCGGTGG + Intergenic
1190082883 X:47370640-47370662 CGGAAGGTGGGCTGAGGCCCAGG + Exonic
1190971741 X:55356611-55356633 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
1191185583 X:57607735-57607757 CGGAAAGGGAGCTGAAGCCAGGG - Intergenic
1191766747 X:64706058-64706080 TGGAAGGGGGGCTGAAGCCGGGG - Intergenic
1192128996 X:68530441-68530463 TGGAAAGGGAGCTGAAGCCAGGG - Intronic
1193010618 X:76671198-76671220 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
1193034458 X:76934391-76934413 TGGAAAGGGAGCTGAAGCCAGGG + Intergenic
1193616014 X:83688868-83688890 TGGAAAGGGAGCTGAAGCCAAGG - Intergenic
1194315306 X:92369488-92369510 TGGAAAGGGAGCTGAAGCCAGGG - Intronic
1194391149 X:93319599-93319621 CGGAAAGGGGGCTGAAGCCAGGG + Intergenic
1194643422 X:96429563-96429585 TGGAAGGGGGGCTGAAGCCAGGG - Intergenic
1195108563 X:101623506-101623528 CGGAAAGGGAGCTGTGGCCTGGG + Intronic
1197906231 X:131428429-131428451 CGGAAAGGGGGCTGAAGCCAGGG + Intergenic
1199978327 X:152907257-152907279 TGAGAGGGGAGCTGACGCAGGGG - Intergenic
1200623354 Y:5481023-5481045 TGGAAAGGGAGCTGAAGCCAGGG - Intronic