ID: 1091263674

View in Genome Browser
Species Human (GRCh38)
Location 11:134253819-134253841
Sequence GGGGGGGTGACTGGCCGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091263674_1091263687 1 Left 1091263674 11:134253819-134253841 CCCTTCCGGCCAGTCACCCCCCC 0: 1
1: 0
2: 2
3: 11
4: 186
Right 1091263687 11:134253843-134253865 GCCTGGCTCCCTACTCCGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 153
1091263674_1091263698 29 Left 1091263674 11:134253819-134253841 CCCTTCCGGCCAGTCACCCCCCC 0: 1
1: 0
2: 2
3: 11
4: 186
Right 1091263698 11:134253871-134253893 CCCGGCCTGGCTGCCCCCTCCGG 0: 1
1: 0
2: 6
3: 149
4: 2064
1091263674_1091263693 16 Left 1091263674 11:134253819-134253841 CCCTTCCGGCCAGTCACCCCCCC 0: 1
1: 0
2: 2
3: 11
4: 186
Right 1091263693 11:134253858-134253880 CCGGCCGGTCACCCCCGGCCTGG 0: 1
1: 2
2: 3
3: 9
4: 176
1091263674_1091263685 -3 Left 1091263674 11:134253819-134253841 CCCTTCCGGCCAGTCACCCCCCC 0: 1
1: 0
2: 2
3: 11
4: 186
Right 1091263685 11:134253839-134253861 CCCGGCCTGGCTCCCTACTCCGG 0: 1
1: 0
2: 1
3: 23
4: 267
1091263674_1091263691 11 Left 1091263674 11:134253819-134253841 CCCTTCCGGCCAGTCACCCCCCC 0: 1
1: 0
2: 2
3: 11
4: 186
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091263674 Original CRISPR GGGGGGGTGACTGGCCGGAA GGG (reversed) Intronic
900111314 1:1006791-1006813 GGAGTGGTGACTGGCCAGATGGG + Intergenic
900491258 1:2950258-2950280 CGAGGGGTGCCTGGCAGGAACGG - Intergenic
902676073 1:18009350-18009372 GGGGTGGGGGCTGGCCTGAAAGG - Intergenic
902798649 1:18815864-18815886 GGGTGGGGGACTGGCGGGAGAGG - Intergenic
906116230 1:43359052-43359074 GAGGGGGTGCTAGGCCGGAAGGG + Exonic
906206997 1:43992159-43992181 GGGGAGGGGAGTGTCCGGAATGG - Intronic
906238755 1:44228696-44228718 GGGGATGTGCCTGGCCGGGAGGG + Intronic
909203625 1:72725511-72725533 GGGAGGGGCACTGGCAGGAACGG - Intergenic
910657605 1:89633726-89633748 AGGGGGGTGATAGACCGGAAAGG - Intronic
912454398 1:109788075-109788097 TGGGGGCTGACTGGCCGGACTGG + Intergenic
913156560 1:116105193-116105215 GGGGAGGTGACTGCCCAGAGAGG - Intergenic
915286431 1:154856245-154856267 GGGAGGGAGGCTGGCCAGAAGGG + Intronic
915288466 1:154867705-154867727 GGGGGGGTGGCTGGGCGGGCTGG - Intronic
917860132 1:179136100-179136122 GACGGGGTGGCTGGCCGGACGGG - Intronic
919104361 1:193130413-193130435 GAAGGGGTGACTGGCCATAAGGG - Intronic
921229571 1:213055202-213055224 GGGGGAGTGACTGACTGCAAAGG - Intronic
923463210 1:234225164-234225186 GGGGGGGAGACTTGCAGAAAAGG - Intronic
1062830735 10:603926-603948 GGAGGGGTGCCGGGCCGGAGGGG - Intronic
1070257965 10:74826814-74826836 GGGGAGGAGACTGGGCGGGAGGG + Intronic
1070658225 10:78285766-78285788 GGGGTGGTGGGTGGCAGGAAGGG + Intergenic
1070954431 10:80454798-80454820 GGGTGGGTGACTGAGCCGAAAGG - Intronic
1071433815 10:85627914-85627936 GGGGGAGTGACTGGCAGGAGGGG - Intronic
1073000056 10:100278125-100278147 GACGGGGTGGCTGGCCGGGAGGG - Intronic
1073045251 10:100633974-100633996 GGGCAGGTGACTGGCCTGAGAGG - Intergenic
1073088308 10:100910459-100910481 AGGGGGGTTACTGGGGGGAAAGG - Intergenic
1073327994 10:102653540-102653562 GATGGAGTGACTGGCAGGAAAGG + Intronic
1074552055 10:114453426-114453448 GGGCGGCTGTCTGGCCGGTAAGG + Exonic
1081787472 11:45757532-45757554 GAGGGGGTGACTGGCCTAACTGG - Intergenic
1082035555 11:47642601-47642623 GGGGCGGGGACTGGGCGGAGAGG - Exonic
1083309601 11:61777537-61777559 GGGGGCGTGACTACGCGGAAAGG + Intronic
1083380102 11:62260330-62260352 TGGGTGGTGACTGGCAGGGAAGG - Intergenic
1083417280 11:62533911-62533933 GTGGATGTGACTGGCCGGGAAGG - Exonic
1083764832 11:64836712-64836734 GGGGGGGGGGGTGGGCGGAAGGG + Intronic
1083943603 11:65911840-65911862 GGGCGGGTGGCAGACCGGAAAGG + Intergenic
1083976583 11:66126863-66126885 TGGGAGGTGACTGGCAGCAAGGG + Intronic
1084319539 11:68365736-68365758 GGGGCGGGGCCTGGCGGGAATGG + Intronic
1085392596 11:76190055-76190077 GGAGGGGAGACTGCCCGGGAGGG + Intronic
1086017285 11:82182206-82182228 GGCGGGGTGGCTGGCCGGGAGGG - Intergenic
1087093450 11:94298568-94298590 GGCAGGGTGACTGGAGGGAAGGG + Intergenic
1089452396 11:118607539-118607561 GGGGCGGGGACTGGCGGGAGGGG + Intronic
1089603139 11:119627155-119627177 GGCGGGCTGCCTGGCAGGAAGGG + Intronic
1091263666 11:134253788-134253810 GCCGGGGTGACTGGATGGAACGG - Intronic
1091263674 11:134253819-134253841 GGGGGGGTGACTGGCCGGAAGGG - Intronic
1091263767 11:134254034-134254056 GGGGGGATGACCGGCCGGAGGGG - Intronic
1091670116 12:2446593-2446615 GGGTGGGTGGCTGGCTGGATAGG + Intronic
1092077391 12:5685146-5685168 GGGCTGGTGAGTGGCAGGAAAGG + Intronic
1094424665 12:30305540-30305562 GTGGGGGTGACAGGCTGGTAGGG + Intergenic
1101600615 12:106206301-106206323 GAGGAGGTGACTGGCCTGAATGG + Intergenic
1104774794 12:131384793-131384815 GGGGGGAGGACTGGCAGGGAAGG - Intergenic
1106324782 13:28677873-28677895 GGTGGGGTGACTGACTGAAAAGG - Intronic
1112026253 13:95413924-95413946 GGCGGGGTGACTTCCCAGAAAGG - Intergenic
1113376637 13:109770174-109770196 GGGGCTGTGGCTGGCAGGAAAGG + Intronic
1116005177 14:39285280-39285302 GGGGTGGTGGCTGGGCAGAAGGG + Intronic
1117953500 14:61105117-61105139 GTGGGGTTGACTGGCCAGTAAGG - Intergenic
1121124953 14:91400002-91400024 GTGGGGTTGACTGGCAGGGAAGG - Intronic
1122539994 14:102492759-102492781 GGGGGCGTGTGTGTCCGGAAGGG + Intronic
1123044428 14:105504269-105504291 GTGGGGGTGCCTGGCTGGAGGGG + Intergenic
1123429664 15:20203940-20203962 GGCGGGGTGGCTGGCCGGGCGGG + Intergenic
1128398654 15:67254701-67254723 GAGGGGGAGACAGGCCGGAGAGG + Exonic
1128899083 15:71402762-71402784 GGGGGTGTGACTGACTGGATTGG + Intronic
1129250206 15:74304614-74304636 GGGGAGGGGACTGGCCTGCAGGG - Intronic
1129467661 15:75732922-75732944 GGGAGAGGGACTGGCCGGCAGGG + Intergenic
1129731267 15:77934044-77934066 GGGGAGGTGACTGGGTGGAGAGG + Intergenic
1133140845 16:3742918-3742940 CAGGAGGTGACTGGGCGGAATGG - Intronic
1134744895 16:16580473-16580495 GAGGGGGTTACTGGCTGCAAGGG + Intergenic
1135000589 16:18773296-18773318 GAGGGGGTTACTGGCTGCAAGGG - Intergenic
1135277898 16:21129122-21129144 GGGGAGGTGACAGGCAGGACAGG - Intronic
1136668664 16:31836788-31836810 GACGGGGTGGCTGGCCGGACGGG - Intergenic
1138515835 16:57535236-57535258 GGGGAGCTGGCTGGCGGGAAAGG + Intronic
1139231100 16:65283295-65283317 GGGGGGGTGCCTGGCAGCAGTGG + Intergenic
1139964789 16:70739292-70739314 GGAGGGGTGAGTGGGAGGAAGGG + Intronic
1141619037 16:85227008-85227030 GGGTGGGTGAATGGATGGAAAGG - Intergenic
1141690463 16:85593601-85593623 GGGGGAGTGAGGGGCCGGGAGGG - Intergenic
1142050473 16:87954832-87954854 AGGGGAGTGACTGGCCGTACGGG - Intronic
1143109688 17:4546064-4546086 GTGGGGGTGACTGGCCAGGGCGG - Intronic
1144107354 17:11997800-11997822 GCGGGTGGGACTGGGCGGAAGGG - Intergenic
1144853895 17:18257823-18257845 GGGTGGGTGACTGGCAGGGTCGG - Intronic
1145309801 17:21695090-21695112 GGGTGGGTGACTGAGCGGATGGG - Intronic
1146686896 17:34847198-34847220 GGAGGGGTGACTGGGCAGCAGGG - Intergenic
1148404449 17:47398252-47398274 GGCGGGGTGGCTGGCCGGGCGGG - Intronic
1148406586 17:47421035-47421057 GGCGGGGTGGCTGGCCGGGCGGG - Intronic
1148564163 17:48623493-48623515 GGGTGGGTGGCTGACCTGAAGGG + Intronic
1148603202 17:48909083-48909105 GTGGGGGAGGGTGGCCGGAATGG - Intronic
1148931826 17:51133104-51133126 GGGGTGGTGTCTGGTCAGAAAGG + Intergenic
1152617962 17:81346365-81346387 GGGGGCGTGGCTGGCGGGAGGGG + Intergenic
1152813061 17:82391275-82391297 GGTGGGGTGGCTGGCAGGGAGGG - Intronic
1153227244 18:2908285-2908307 GGGTGGGTGGCTGGATGGAAGGG - Intronic
1156379668 18:36546591-36546613 GGGAGGGTGTCAGGCTGGAATGG + Intronic
1158245141 18:55423891-55423913 GGGGTGGTGACTGGGCGGAAGGG + Intronic
1158350930 18:56563803-56563825 AGGGGGCTGACTGGCTGCAAGGG - Intergenic
1161363982 19:3868159-3868181 GGGAGGGTGTCTGGCTGGACAGG - Intronic
1161364027 19:3868330-3868352 GGGAGGGTGCCTGGCCGGGCAGG - Intronic
1161722140 19:5909018-5909040 GCCGGGGTCACTGGCCGGCAGGG - Exonic
1161856306 19:6767702-6767724 GGAGGGGCCACTGGCAGGAAAGG - Intergenic
1162099965 19:8333611-8333633 GGCGAGGTGCCTGGCGGGAAGGG + Intronic
1162381626 19:10334987-10335009 GGGGCGGAGACTAGCCGAAAAGG - Intronic
1162381719 19:10335335-10335357 GGGGGGGTCACGGGCAGGACTGG + Exonic
1163721592 19:18900498-18900520 GTGGGGGTGACGGGCAGGCATGG - Intronic
1164217237 19:23160926-23160948 GGTGGGGTGGCTGGCCGGGCGGG + Intergenic
1166258201 19:41620499-41620521 CAGGGGGTGACTGGCAGGAGTGG + Intronic
1166267200 19:41691539-41691561 GGGGAGGTGCCAGGCCGGGAGGG + Intronic
1166872240 19:45877697-45877719 GGGGGGGTGCCTGCCAGGGAGGG - Intergenic
1167898505 19:52601103-52601125 GGAAGGGAGACTGGCCGGGAAGG - Intronic
1168723420 19:58567707-58567729 GTGGGGCTTACTGGCTGGAAGGG - Intronic
927373261 2:22382619-22382641 GGGGTGGCTACTGGCCAGAAGGG - Intergenic
928858490 2:35827997-35828019 GGGGGGGTGGCTGGGGGGAGGGG + Intergenic
929936831 2:46299095-46299117 AGGGAGGTGACTGGCCGGGAGGG + Intronic
929962622 2:46507889-46507911 TGGGGGCTGACTTCCCGGAAGGG + Intronic
932462755 2:71893883-71893905 GGGTGGGTGGCTGTCCGGGACGG + Intergenic
933750977 2:85602090-85602112 GAGTGGGTAACTGGCCGGGAAGG + Exonic
935891974 2:107688610-107688632 GGAAGGGTGACTGGCAGGAGTGG - Intergenic
937236905 2:120436698-120436720 GGGTGGGTGGCTGGCTGGAGGGG - Intergenic
938190286 2:129273571-129273593 GGGAGGGTCACTGACGGGAATGG + Intergenic
938886071 2:135649965-135649987 GTGGGTGAGACTGGCAGGAACGG - Intronic
939264047 2:139849154-139849176 TAGGGGGTGACTGGCCAGAACGG + Intergenic
939965078 2:148602429-148602451 GGGTGGGTGACTGGCTGGAAAGG - Intergenic
940883347 2:158968616-158968638 GGCGGGGGGACGGGCCGGAGCGG + Intronic
942179613 2:173367385-173367407 GGGGTGGAGACTGACTGGAACGG + Intronic
943566941 2:189527055-189527077 GGGAGGGTGACTGGACTGAGAGG - Intergenic
945735216 2:213590344-213590366 GGGAGGGTGAATGGAGGGAAAGG - Intronic
947868455 2:233418341-233418363 GGGGGGGCCTCTGGCAGGAAGGG - Intronic
1171768239 20:29301633-29301655 GGAGGGGCGACTGGCGGGTAGGG - Intergenic
1171899831 20:30846997-30847019 GGCGGGGTGGCTGGCCGGGCGGG + Intergenic
1172109499 20:32536827-32536849 GGGGGGGGGACACGCAGGAACGG + Intronic
1173884045 20:46441184-46441206 GGGGGTGTGATTGGAAGGAAGGG - Intergenic
1174069525 20:47889876-47889898 GGGTGTGTGAGTGGCCGGAGAGG + Intergenic
1175237493 20:57524936-57524958 GAGGGAGGGGCTGGCCGGAAAGG - Intronic
1175386194 20:58596906-58596928 GGGGGGGTGTGTGGCCAGCAAGG + Intergenic
1175721081 20:61287744-61287766 GGGGGAGTGGCTGGCAGGCAGGG - Intronic
1176219488 20:63963283-63963305 GGGTGGGTGAGTGGCCAGCAGGG + Intronic
1177427240 21:20939397-20939419 GGGGAGGTGCCTGGCGGGAGGGG - Intergenic
1179886030 21:44314592-44314614 GGGGGGGTGCCTGGTGGGGAGGG + Intronic
1180609494 22:17085962-17085984 GGGGGTGGGAGTGGCGGGAAGGG - Intronic
1181604222 22:23970780-23970802 GGGGGGATGAATGGCAGGTAAGG - Intronic
1182523992 22:30904118-30904140 TGGGGGGTGGCTGGCAGCAAGGG + Intronic
1183845566 22:40537733-40537755 GACGGGGTGACTGGCCGGGTGGG - Intronic
1184951048 22:47842830-47842852 GGGGTGGTGGCTGGCAGGTAGGG - Intergenic
1185298051 22:50063881-50063903 GGGGAGGTGAGTGGCCTGCAGGG - Intronic
1185298104 22:50064017-50064039 GGGGAGGTGAGTGGCCTGCAGGG - Exonic
950966276 3:17148607-17148629 AGGGAGGTGACAGGCAGGAATGG + Intergenic
951688785 3:25373855-25373877 GGGGGACTAACTGGCAGGAAAGG + Intronic
952859515 3:37801295-37801317 GGGGTGGGGACTGGAAGGAAGGG + Intronic
953328914 3:42035598-42035620 TGGGAGGTGACTGACCAGAAGGG - Intronic
953546525 3:43867533-43867555 GGGGGGGTGACTGGTCAGACTGG + Intergenic
954413341 3:50380823-50380845 GTGAGGGGGACTGGCAGGAAAGG + Intronic
954980506 3:54741139-54741161 GTGGGGGTGGATGGCGGGAAGGG + Intronic
955061265 3:55493360-55493382 GTGAGGGTGACTGGTCAGAAGGG - Intergenic
956674129 3:71718957-71718979 GGGGAGGAGACTGGATGGAAGGG - Intronic
965544757 3:169904034-169904056 GGGCGGGGGTCTGGCAGGAATGG - Intergenic
966977028 3:185093809-185093831 GGTGAGGTGACTGGCCTGAATGG + Intronic
968518866 4:1026763-1026785 GGGGTGGTGTCTGGCCTGGACGG - Exonic
968530764 4:1090211-1090233 GTGGGGGTGACAGGATGGAAGGG + Intronic
968850339 4:3074133-3074155 GGGGAGGGGACTGGCCGGTGAGG - Intergenic
969552657 4:7881312-7881334 GTGGGGGTGCCTGGCAGGAGAGG - Intronic
971198508 4:24491699-24491721 GGGTGGGTGACTGGATGGATGGG + Intergenic
974090601 4:57306508-57306530 GTGGGGGTGAGGGGCAGGAAAGG + Intergenic
974229533 4:59091865-59091887 GGGTGGGTCACTGGGCAGAAAGG + Intergenic
981523990 4:145693687-145693709 GAGGGGGCGGCTGGCCGGACGGG + Intronic
984734587 4:183098364-183098386 GGGCGGGCGGCTGGACGGAAGGG + Intergenic
986043933 5:4019788-4019810 GTGGGGGTGACTGGCATGCAGGG - Intergenic
991426223 5:66494788-66494810 GGGGCGGTGGGTGGCAGGAAAGG + Intergenic
991703130 5:69333944-69333966 GGGGGCCTGGCTGGCCGGAGGGG - Intergenic
996730911 5:126716610-126716632 GGCGGGGTGACTGGTTGGGATGG + Intergenic
997567574 5:134901331-134901353 GGGGTGGTCACTGGCAGGAGGGG + Exonic
999304697 5:150511969-150511991 GGGGGTGTGACTGGCTGGGAGGG + Intronic
999999119 5:157120614-157120636 GGGGGCTTGACTGCCAGGAATGG - Intronic
1002597723 5:180335039-180335061 GAGGGGGTGACTGGGCGAACAGG + Intronic
1006209896 6:32385286-32385308 GACGGGGTGGCTGGCCGGGAGGG + Intergenic
1007616084 6:43180395-43180417 GAGGGGGTGAGAGGCAGGAATGG + Exonic
1013225516 6:108117620-108117642 GGGGAGGTGACAGGCCAGAGAGG + Intronic
1015126711 6:129763200-129763222 GGGGGGGGTAATGGCAGGAATGG - Intergenic
1020786424 7:12578966-12578988 GGAGGGGTGAGTGGCAGGAATGG - Intronic
1023160745 7:37293109-37293131 GACGGGGTGGCTGGCCGGACGGG - Intronic
1029460527 7:100691685-100691707 GGGCGGGGGACAGGCTGGAAGGG - Intergenic
1034430788 7:151040296-151040318 GGGCAGGTGAGTGGCCGGTAGGG + Exonic
1034956287 7:155337448-155337470 GGGGGGGTGACTGAAGGGCATGG + Intergenic
1036402293 8:8420131-8420153 GGGGAGGGGACTGGACAGAAAGG + Intergenic
1037607214 8:20448005-20448027 GGGAGGGTGACAGGGCGGCACGG + Intergenic
1041062149 8:54044576-54044598 TGGGGGGTGACGGGGTGGAAGGG + Intergenic
1041358198 8:57022393-57022415 GATGGGGTGGCTGGCCGGGAGGG - Intergenic
1042491848 8:69408298-69408320 GGGGGGGTGGGTGGGGGGAAGGG + Intergenic
1044562442 8:93626569-93626591 TGGGGGGTGACAGGACGGAGTGG - Intergenic
1049335077 8:142079960-142079982 GGGGGCGTGACTGGCAGGCCTGG + Intergenic
1049477092 8:142801843-142801865 GGGTGGGTGAGTGGGTGGAAGGG + Intergenic
1049673558 8:143880023-143880045 GGAGGGGTGACGGGCAGAAATGG - Intergenic
1049673574 8:143880088-143880110 AGGGGGGTGACGGGCAGAAATGG - Intergenic
1050558259 9:6807906-6807928 GAGGGGGTGGCTGGCCGGGCTGG - Intronic
1056564171 9:87758540-87758562 GACGGGGTGGCTGGCCGGGAGGG + Intergenic
1056974313 9:91236664-91236686 TGTGGGGTGACTGGGCTGAATGG + Intronic
1057307502 9:93920727-93920749 GGGGGAGTGTCTGGCCTGGAGGG - Intergenic
1057611314 9:96546385-96546407 GGGGTGATGACTGACTGGAAAGG + Intronic
1061015837 9:127980544-127980566 GGCGGGCTGGCTGGCCGGTAAGG + Intergenic
1061101596 9:128496491-128496513 GGAAGGGTGACTGGCAAGAAAGG - Intronic
1061181764 9:129028470-129028492 GGGGGCGGGACTGGCGGGACAGG + Intergenic
1062330966 9:136044807-136044829 TGGGGGGTGAGTGGCTGCAACGG + Intronic
1189717737 X:43882565-43882587 GGGCGGGTGCCTGGGCGGAGAGG + Intergenic
1190261840 X:48802339-48802361 GGGGCGGTGATTGGTTGGAAAGG + Intronic
1191068928 X:56380171-56380193 GGTGGGGTGGCTGGCCGGGTGGG + Intergenic
1194762234 X:97808828-97808850 GGGAGGGTGATTGACCTGAATGG + Intergenic
1198664464 X:139004987-139005009 GGGGAGGTCACTGCCCTGAAGGG + Intronic