ID: 1091263675

View in Genome Browser
Species Human (GRCh38)
Location 11:134253820-134253842
Sequence CGGGGGGGTGACTGGCCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091263675_1091263691 10 Left 1091263675 11:134253820-134253842 CCTTCCGGCCAGTCACCCCCCCG 0: 1
1: 0
2: 1
3: 10
4: 240
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263675_1091263687 0 Left 1091263675 11:134253820-134253842 CCTTCCGGCCAGTCACCCCCCCG 0: 1
1: 0
2: 1
3: 10
4: 240
Right 1091263687 11:134253843-134253865 GCCTGGCTCCCTACTCCGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 153
1091263675_1091263685 -4 Left 1091263675 11:134253820-134253842 CCTTCCGGCCAGTCACCCCCCCG 0: 1
1: 0
2: 1
3: 10
4: 240
Right 1091263685 11:134253839-134253861 CCCGGCCTGGCTCCCTACTCCGG 0: 1
1: 0
2: 1
3: 23
4: 267
1091263675_1091263693 15 Left 1091263675 11:134253820-134253842 CCTTCCGGCCAGTCACCCCCCCG 0: 1
1: 0
2: 1
3: 10
4: 240
Right 1091263693 11:134253858-134253880 CCGGCCGGTCACCCCCGGCCTGG 0: 1
1: 2
2: 3
3: 9
4: 176
1091263675_1091263698 28 Left 1091263675 11:134253820-134253842 CCTTCCGGCCAGTCACCCCCCCG 0: 1
1: 0
2: 1
3: 10
4: 240
Right 1091263698 11:134253871-134253893 CCCGGCCTGGCTGCCCCCTCCGG 0: 1
1: 0
2: 6
3: 149
4: 2064

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091263675 Original CRISPR CGGGGGGGTGACTGGCCGGA AGG (reversed) Intronic
900111313 1:1006790-1006812 AGGAGTGGTGACTGGCCAGATGG + Intergenic
900477209 1:2881634-2881656 CGGCAGTGGGACTGGCCGGAGGG - Intergenic
901100358 1:6715108-6715130 CGACGGGGCGGCTGGCCGGACGG + Intergenic
902652968 1:17848685-17848707 CAGGGGGGTGGGTGGCGGGAGGG - Intergenic
902794172 1:18790074-18790096 AGGGGCGGTGACTGGCAGGAGGG + Intergenic
903081840 1:20816708-20816730 CGGGGTGGTGGCCGGGCGGAGGG - Intronic
903508268 1:23853529-23853551 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
906211648 1:44015642-44015664 CTGAGGGGTGCCTGGCCGGAAGG - Intronic
907216532 1:52869773-52869795 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
909479039 1:76112621-76112643 CGGGGCGGTTGCTGGGCGGAGGG + Intronic
911325776 1:96469624-96469646 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
911486458 1:98512312-98512334 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
914987285 1:152471933-152471955 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
917205961 1:172571851-172571873 CGGGGGGGCTGCGGGCCGGACGG - Intronic
917553331 1:176058098-176058120 CGACGGGGTGGCTGGCCGGGCGG - Intronic
917860133 1:179136101-179136123 GGACGGGGTGGCTGGCCGGACGG - Intronic
918818896 1:189226038-189226060 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
920143844 1:203841682-203841704 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
920749387 1:208659465-208659487 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
920795113 1:209129668-209129690 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
921142310 1:212320474-212320496 CGGGGTGGTGGCTGGACAGAGGG + Intronic
924482799 1:244451958-244451980 CGGGGCGGGGACTGGCTGGAGGG - Exonic
1062830736 10:603927-603949 TGGAGGGGTGCCGGGCCGGAGGG - Intronic
1065594166 10:27296090-27296112 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
1067331932 10:45330609-45330631 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
1068005864 10:51392660-51392682 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
1071433816 10:85627915-85627937 TGGGGGAGTGACTGGCAGGAGGG - Intronic
1075319434 10:121478208-121478230 CACGGGGGTGACTTGCCAGAGGG - Intergenic
1075438409 10:122461458-122461480 CGGGATGGGGGCTGGCCGGATGG - Intergenic
1075902108 10:126051469-126051491 CGGGTGGCTGGCTGGACGGATGG - Intronic
1077080134 11:721423-721445 CAGGCTGGGGACTGGCCGGAGGG - Intronic
1080098394 11:28431245-28431267 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1082244992 11:49911622-49911644 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
1082844448 11:57716111-57716133 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
1084061467 11:66678022-66678044 CAGGGTGGTGACTGGCTGGCTGG - Intergenic
1084338294 11:68475442-68475464 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
1085359841 11:75877378-75877400 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
1085403071 11:76246054-76246076 CGGGGCTGTGACTGCCCAGATGG + Intergenic
1085480955 11:76821814-76821836 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1086017286 11:82182207-82182229 GGGCGGGGTGGCTGGCCGGGAGG - Intergenic
1086881769 11:92158375-92158397 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1089262641 11:117232894-117232916 CGGGGGGGTGGCTGGCAGCGGGG + Intronic
1089452395 11:118607538-118607560 GGGGGCGGGGACTGGCGGGAGGG + Intronic
1090440014 11:126717603-126717625 GGTGGGGGTGACTGGCCAGCAGG - Intronic
1091263675 11:134253820-134253842 CGGGGGGGTGACTGGCCGGAAGG - Intronic
1091263768 11:134254035-134254057 CGGGGGGATGACCGGCCGGAGGG - Intronic
1094716881 12:33022698-33022720 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
1095571062 12:43685122-43685144 CGGGGCGGTTGCTGGGCGGAGGG - Intergenic
1096683784 12:53274464-53274486 CTGGTAGGTGACTGGCGGGAGGG + Intronic
1098019268 12:66135527-66135549 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
1098884049 12:75942578-75942600 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1101317686 12:103643997-103644019 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
1102514191 12:113435425-113435447 CGGGGTGGTGGCTGGCCTGCTGG + Exonic
1104657100 12:130581526-130581548 GGGTGGGGAGACTGGCAGGAAGG - Intronic
1104676531 12:130715353-130715375 CGGGGTGGCGGCTGGCCGGAGGG - Intronic
1104943451 12:132405327-132405349 CGTGGGGGTCACCGGCAGGATGG + Intergenic
1104954485 12:132457640-132457662 CGGGCGGGTGAGTGGCTGGGTGG + Intergenic
1107493423 13:40901288-40901310 CGACGGGGCGACTGGCCGGGCGG - Intergenic
1113768324 13:112894287-112894309 CGGGGCGGGGGCGGGCCGGAGGG - Intergenic
1113936679 13:113998561-113998583 CGGCGGGGTCACTGGCTGAAGGG + Intronic
1115504360 14:34079253-34079275 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
1116005176 14:39285279-39285301 CGGGGTGGTGGCTGGGCAGAAGG + Intronic
1116841337 14:49821774-49821796 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
1118033262 14:61838963-61838985 CGGGGGGGTGGGGGGCCGGTGGG - Intergenic
1118955623 14:70477775-70477797 CGGCGGGGCGGCTGGCCGGGCGG - Intergenic
1119798010 14:77416731-77416753 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
1121552372 14:94812436-94812458 CGTTGGGGCTACTGGCCGGAAGG - Intergenic
1122887585 14:104717283-104717305 CGGGGGGGGGACTGGGAGGACGG - Intronic
1123044427 14:105504268-105504290 GGTGGGGGTGCCTGGCTGGAGGG + Intergenic
1202848160 14_GL000009v2_random:200272-200294 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1123429663 15:20203939-20203961 GGGCGGGGTGGCTGGCCGGGCGG + Intergenic
1124250423 15:28103505-28103527 CGGAGGGATGACTAGCTGGAGGG + Intergenic
1125457823 15:39878865-39878887 GGGAGGGGTGGCTGGCCGAAAGG + Intronic
1126691968 15:51294711-51294733 CCGGGGGGCGGCTGGCCAGACGG - Intronic
1128374638 15:67066162-67066184 CGGGGGAGTGAAAGGCAGGATGG - Exonic
1131043744 15:89296723-89296745 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
1136072466 16:27796167-27796189 CGGCTGGGTGATTGGCCGGAAGG - Intronic
1136668665 16:31836789-31836811 GGACGGGGTGGCTGGCCGGACGG - Intergenic
1138043676 16:53698854-53698876 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
1140067778 16:71625694-71625716 CGGGTGGGTGAGTGGGTGGATGG + Intergenic
1141728710 16:85808141-85808163 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
1141984355 16:87570433-87570455 CGGGGTGGGGACTGGGCGCAGGG + Intergenic
1142050474 16:87954833-87954855 AAGGGGAGTGACTGGCCGTACGG - Intronic
1142128570 16:88422074-88422096 CGGGTGGCTGACTGGGTGGATGG + Intergenic
1142354914 16:89597757-89597779 CGGGGGGATGGGTGGACGGATGG - Intergenic
1142354927 16:89597785-89597807 CGGGGGGATGGGTGGACGGATGG - Intergenic
1142355063 16:89598140-89598162 CGGATGGGTGAGTGGACGGATGG - Intergenic
1142355091 16:89598224-89598246 CGGGGGGATGGGTGGGCGGATGG - Intergenic
1144510033 17:15867587-15867609 CGACGGGGTGGCTGGCCGGGCGG - Intergenic
1145309802 17:21695091-21695113 TGGGTGGGTGACTGAGCGGATGG - Intronic
1145933464 17:28701757-28701779 CGGATGGGTGACAGGCTGGATGG + Exonic
1146276908 17:31522067-31522089 CTGGGGGGTGAGAGGCCGGGGGG + Intronic
1146930224 17:36771727-36771749 CGTGGGGGTGAGTAGCGGGAGGG + Intergenic
1148404450 17:47398253-47398275 GGGCGGGGTGGCTGGCCGGGCGG - Intronic
1148406587 17:47421036-47421058 GGGCGGGGTGGCTGGCCGGGCGG - Intronic
1150848439 17:68682472-68682494 CGGGGGGGTGGGTGGCTGAATGG - Intergenic
1151535554 17:74737135-74737157 CGAGGGGGCGACGGGACGGAGGG + Intronic
1152617961 17:81346364-81346386 AGGGGGCGTGGCTGGCGGGAGGG + Intergenic
1154278076 18:12979597-12979619 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
1157455881 18:47828152-47828174 CGGGGTGGTTGCTGGGCGGAGGG - Exonic
1158245140 18:55423890-55423912 AGGGGTGGTGACTGGGCGGAAGG + Intronic
1158350931 18:56563804-56563826 CAGGGGGCTGACTGGCTGCAAGG - Intergenic
1159798450 18:72869071-72869093 CGCGGGTGTGGGTGGCCGGACGG - Intergenic
1160916441 19:1499142-1499164 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
1161031044 19:2057866-2057888 CAGGTGGGTGACTGACCTGAGGG + Intergenic
1161703067 19:5805328-5805350 CGGGGGGGGCCCGGGCCGGAGGG - Intergenic
1161790373 19:6355937-6355959 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1163826466 19:19527374-19527396 TTGGGAGGTCACTGGCCGGAAGG + Intronic
1164055026 19:21615002-21615024 CGGGGTGGCGGCCGGCCGGAGGG - Intergenic
1164217236 19:23160925-23160947 GGGTGGGGTGGCTGGCCGGGCGG + Intergenic
1165091296 19:33389622-33389644 TGGAGGGGTGACTGGAAGGAAGG - Intronic
1165727704 19:38124165-38124187 CGGGGTGGTTGCTGGGCGGAGGG + Intronic
1165902752 19:39176380-39176402 GGGGGAGGTGACTTGCCCGAGGG + Intronic
1166324056 19:42038326-42038348 CCCAGGGGTGACTGGCAGGATGG + Intronic
1167253695 19:48415026-48415048 CGGGGAGGTGAGGGGGCGGACGG + Exonic
1168063345 19:53906451-53906473 CTGGAGGGTGACTGACCGGGCGG - Exonic
925040937 2:732315-732337 CGGGGGGGTCACGGCCCGGGGGG + Intergenic
925041069 2:732666-732688 CGGGGGGGTCACGGCCCGGGGGG + Intergenic
925041141 2:732850-732872 CGGGGGGGTCACGGCCCGGGGGG + Intergenic
925041150 2:732866-732888 CGGGGGGGTCACGGCCCGGGGGG + Intergenic
925400429 2:3569032-3569054 CGGGGTGGTGGCCGGCCAGAGGG + Intergenic
926055298 2:9770837-9770859 CGGAGGGGTGAGTGGCTGGTGGG - Intergenic
927747443 2:25634448-25634470 CGACGGGGCGACTGGCCGGGCGG - Intronic
927860125 2:26555531-26555553 CGAGGGGCCGACTGGCCTGAGGG + Intronic
928196551 2:29220555-29220577 CAGGGGGGTGACTGACTGGCTGG - Intronic
928312789 2:30224290-30224312 AGGGGGGCTGACTGGCAGAAGGG - Intergenic
928858489 2:35827996-35828018 GGGGGGGGTGGCTGGGGGGAGGG + Intergenic
929110822 2:38403846-38403868 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
929936830 2:46299094-46299116 GAGGGAGGTGACTGGCCGGGAGG + Intronic
930027557 2:47038638-47038660 CGGGGGGGTGGGTGGGGGGAGGG - Intronic
930804223 2:55473971-55473993 CCCGGGGGAGAGTGGCCGGAGGG + Intergenic
931584343 2:63809377-63809399 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
931752147 2:65339191-65339213 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
934098447 2:88628468-88628490 CGAGGAGGAGACTGGCCGGGAGG + Intergenic
937236906 2:120436699-120436721 GGGGTGGGTGGCTGGCTGGAGGG - Intergenic
938250100 2:129808077-129808099 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
938757134 2:134391287-134391309 TGGGGTGGTGAATGGCAGGATGG + Intronic
939584855 2:143991999-143992021 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
940417990 2:153444173-153444195 CGGGTGGGTGAGTGGATGGATGG - Intergenic
942454670 2:176129803-176129825 CGGGGGCGAGATTGGCGGGAGGG + Exonic
947518778 2:230828601-230828623 CGGGGCGGTCGCGGGCCGGAAGG - Intergenic
947868456 2:233418342-233418364 CGGGGGGGCCTCTGGCAGGAAGG - Intronic
948651602 2:239449457-239449479 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
948899827 2:240950651-240950673 TGGGTGGGTGAGTGGACGGATGG - Intronic
1171567463 20:26208547-26208569 GAGGGGGGTCACTCGCCGGACGG + Intergenic
1171899830 20:30846996-30847018 GGGCGGGGTGGCTGGCCGGGCGG + Intergenic
1172349204 20:34229113-34229135 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
1172722930 20:37012979-37013001 CAACGGGGTGACTGGCCGGGCGG - Intronic
1175772610 20:61633106-61633128 TGGGTGGGTGAATGGACGGATGG - Intronic
1175898782 20:62351863-62351885 GGGGAGGGGGACTGGCCGGGTGG - Intronic
1176049274 20:63108051-63108073 GGCGGGGGTGACTGCCTGGAAGG - Intergenic
1177427241 21:20939398-20939420 GGGGGAGGTGCCTGGCGGGAGGG - Intergenic
1179681213 21:43022426-43022448 CATGGGAGTGACTGGCCTGAGGG + Intronic
1180609495 22:17085963-17085985 CGGGGGTGGGAGTGGCGGGAAGG - Intronic
1181657739 22:24317058-24317080 GGAGGGGGTGGCTGGCCGGGCGG + Intronic
1183845567 22:40537734-40537756 GGACGGGGTGACTGGCCGGGTGG - Intronic
1183995598 22:41630991-41631013 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
1184396748 22:44246812-44246834 CGTGGGGGTGACCTGCAGGAAGG + Exonic
1184756100 22:46516827-46516849 CGGGGTGGGGACTGGCAGGAAGG + Intronic
1184778280 22:46633983-46634005 CGGGGGTGAGACAGGCCTGAGGG - Intronic
1185173171 22:49305151-49305173 CAGGGGGCTGGCTGGCCGGCAGG - Intergenic
1185285356 22:49997509-49997531 CGGTGGGGTGCTGGGCCGGATGG - Intronic
1185298052 22:50063882-50063904 CGGGGAGGTGAGTGGCCTGCAGG - Intronic
949919957 3:8992901-8992923 TGGGGGGGTGATGGGCCGGTAGG - Exonic
950636286 3:14317434-14317456 CAGGGTAGTGACTGGCCGAAGGG - Intergenic
950754920 3:15163384-15163406 CGGGGCGGTTGCTGGGCGGAGGG + Intergenic
950819638 3:15742841-15742863 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
951290351 3:20866686-20866708 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
953030633 3:39177707-39177729 CGGGGGGGGGAGGGGGCGGAGGG + Intergenic
953193652 3:40712508-40712530 CGGGGCAGTGACTGGCCCAAGGG + Intergenic
953328915 3:42035599-42035621 CTGGGAGGTGACTGACCAGAAGG - Intronic
955362772 3:58289764-58289786 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
959074440 3:101735390-101735412 TGGGGGGGTGGCTGGCAAGATGG + Intronic
959586036 3:108026194-108026216 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
959683942 3:109124595-109124617 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
960866023 3:122201529-122201551 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
961432816 3:126895248-126895270 TGGTGAGGTGACTTGCCGGAGGG + Intronic
961729740 3:128955640-128955662 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
963043670 3:141087229-141087251 CAGTAGGTTGACTGGCCGGAAGG + Intronic
966234707 3:177687647-177687669 AGGGAGGGTGACTGGCTGTAAGG - Intergenic
966909139 3:184548696-184548718 CGGGGTGGTTACTGGGCTGAGGG + Intronic
968316677 3:197731523-197731545 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
971198507 4:24491698-24491720 TGGGTGGGTGACTGGATGGATGG + Intergenic
973109084 4:46377487-46377509 CGGGGCGGTTGCTGGGCGGAGGG - Intronic
979622636 4:122812660-122812682 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
980056555 4:128083945-128083967 CGGGGCGGTTGCTGGGCGGAGGG + Intronic
981523989 4:145693686-145693708 GGAGGGGGCGGCTGGCCGGACGG + Intronic
981677612 4:147358376-147358398 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
982191943 4:152866397-152866419 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
983190265 4:164747279-164747301 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
984004684 4:174294572-174294594 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
986043934 5:4019789-4019811 CGTGGGGGTGACTGGCATGCAGG - Intergenic
989983077 5:50666531-50666553 CGGCGGGGTGACTAGGCGGCGGG + Intronic
991373438 5:65940782-65940804 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
991493941 5:67209820-67209842 CAGGGGAATGAATGGCCGGATGG + Intergenic
991703131 5:69333945-69333967 AGGGGGCCTGGCTGGCCGGAGGG - Intergenic
991723393 5:69515053-69515075 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
992978407 5:82140563-82140585 CGGAGGGGCGGCTGGCCGGGCGG - Intronic
995895014 5:117002293-117002315 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
995942160 5:117599506-117599528 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
996707474 5:126512155-126512177 GGGGGTGCTGACTGGCTGGAGGG - Intergenic
997567573 5:134901330-134901352 TGGGGTGGTCACTGGCAGGAGGG + Exonic
998239145 5:140427045-140427067 CGGGGTGGTGGCCGGGCGGAGGG + Intronic
999304696 5:150511968-150511990 TGGGGGTGTGACTGGCTGGGAGG + Intronic
1000159511 5:158583447-158583469 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1001329833 5:170754360-170754382 CGGGTGGGTGAATGGATGGATGG + Intergenic
1001329906 5:170754612-170754634 CGGGTGGGTGAATGGATGGATGG + Intergenic
1004664057 6:17735198-17735220 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
1009808698 6:68634980-68635002 CGGGGGAGAGGCTGGCGGGAGGG - Intergenic
1015220836 6:130802393-130802415 CGGGGCGGTTGCTGGGCGGAGGG - Intergenic
1015226175 6:130859937-130859959 CGGGAGAGTGAATGGCTGGAGGG + Intronic
1017660781 6:156670631-156670653 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1018908430 6:168088358-168088380 CGGGCGGGGGAGTGGCCGGGAGG + Intergenic
1019304210 7:325165-325187 CATGGGGCTGACTGGCGGGACGG - Intergenic
1019981448 7:4624366-4624388 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1020382997 7:7566813-7566835 GGGCGGGGTCACTGGCCGGGAGG - Intergenic
1021717147 7:23470526-23470548 CAGAAGGGTGACTGGCAGGAGGG + Intergenic
1023160746 7:37293110-37293132 AGACGGGGTGGCTGGCCGGACGG - Intronic
1024309943 7:47959835-47959857 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
1024539020 7:50460515-50460537 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
1025808590 7:64857114-64857136 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1026236925 7:68535107-68535129 CGGGGTGGTGGGTGGCCGGGGGG + Intergenic
1026879732 7:73900840-73900862 CGGGGGAGGGACTGCCAGGATGG - Intergenic
1028180395 7:87714753-87714775 CGGGGGGGTGCCTGTCCATATGG - Intronic
1029334335 7:99887838-99887860 CGGGGTGGTGGCTGGGCAGAGGG + Intronic
1031871296 7:127091845-127091867 CGGGGGGGTCATTGGCGGGACGG - Intronic
1031871357 7:127092016-127092038 CGGGGGGATGACTAGTGGGATGG - Intronic
1031922543 7:127612544-127612566 TGGGTGGGTGACTGGCTGGCTGG + Intronic
1032042692 7:128576539-128576561 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
1032090117 7:128907356-128907378 CTGGGGCGTGCCTGGCCCGAGGG - Exonic
1034445424 7:151111572-151111594 CAGGGGGGTGAGGGGCCGGGGGG - Intronic
1035282541 7:157787037-157787059 CGCGGGGGTGGCTGCCCGGGAGG + Intronic
1035282559 7:157787082-157787104 CGCGGGGGTGGCTGCCCGGGAGG + Intronic
1035282577 7:157787127-157787149 CGCGGGGGTGGCTGCCCGGGAGG + Intronic
1038267460 8:26047730-26047752 CGGGGGGTTGGCTGGGAGGAGGG - Intergenic
1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG + Intergenic
1041070995 8:54125906-54125928 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1046636509 8:116679355-116679377 CGGGGGGCTGACCGGGCGGGGGG - Intronic
1048389519 8:133948172-133948194 TGGGGGGGTGGCTGGGGGGAGGG + Intergenic
1051560796 9:18438406-18438428 CGTGGGGGTGGCTGCCCTGACGG - Intergenic
1056818331 9:89817744-89817766 GGGAGGGGTGGCTGGCCGGTGGG + Intergenic
1060041586 9:120305254-120305276 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1060350313 9:122852847-122852869 CGGGGTGGTGGCTGGGCAGAGGG - Intronic
1060967989 9:127722268-127722290 CTGCGGGGTGACTGGCTGGCAGG - Intronic
1061982583 9:134115311-134115333 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic
1062500398 9:136849636-136849658 CGGGGGCGGGGCTGGCGGGACGG + Intronic
1189578017 X:42375721-42375743 CTGGGGGGTCTCTGGCTGGAAGG + Intergenic
1190737757 X:53266888-53266910 CGGGGGGGTGGGTGGGGGGAAGG + Intronic
1191068927 X:56380170-56380192 GGGTGGGGTGGCTGGCCGGGTGG + Intergenic
1194611594 X:96051207-96051229 CGGGGTGGTTGCTGGGCGGAGGG + Intergenic
1197736298 X:129851436-129851458 CGGGGTGGTGGCTGGGCAGAGGG - Intergenic
1198476133 X:136999880-136999902 CGGGGTGGTGGCTGGGCAGAGGG + Intergenic