ID: 1091263679

View in Genome Browser
Species Human (GRCh38)
Location 11:134253828-134253850
Sequence AGCCAGGCCGGGGGGGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 276}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091263679_1091263691 2 Left 1091263679 11:134253828-134253850 CCAGTCACCCCCCCGGCCTGGCT 0: 1
1: 0
2: 1
3: 31
4: 276
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263679_1091263700 24 Left 1091263679 11:134253828-134253850 CCAGTCACCCCCCCGGCCTGGCT 0: 1
1: 0
2: 1
3: 31
4: 276
Right 1091263700 11:134253875-134253897 GCCTGGCTGCCCCCTCCGGTCGG 0: 1
1: 0
2: 1
3: 53
4: 393
1091263679_1091263687 -8 Left 1091263679 11:134253828-134253850 CCAGTCACCCCCCCGGCCTGGCT 0: 1
1: 0
2: 1
3: 31
4: 276
Right 1091263687 11:134253843-134253865 GCCTGGCTCCCTACTCCGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 153
1091263679_1091263698 20 Left 1091263679 11:134253828-134253850 CCAGTCACCCCCCCGGCCTGGCT 0: 1
1: 0
2: 1
3: 31
4: 276
Right 1091263698 11:134253871-134253893 CCCGGCCTGGCTGCCCCCTCCGG 0: 1
1: 0
2: 6
3: 149
4: 2064
1091263679_1091263693 7 Left 1091263679 11:134253828-134253850 CCAGTCACCCCCCCGGCCTGGCT 0: 1
1: 0
2: 1
3: 31
4: 276
Right 1091263693 11:134253858-134253880 CCGGCCGGTCACCCCCGGCCTGG 0: 1
1: 2
2: 3
3: 9
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091263679 Original CRISPR AGCCAGGCCGGGGGGGTGAC TGG (reversed) Intronic
900216280 1:1483490-1483512 AGCCAGGCCTGGTGGCTCACTGG + Intronic
900330055 1:2129634-2129656 AGCCAGGCAGGGGGGGTCTCTGG + Intronic
901212419 1:7534107-7534129 GGCCTGGCGGGCGGGGTGACCGG - Intronic
901226570 1:7616555-7616577 AGCCGGGCCTCGGGGGTGACTGG + Intronic
901628484 1:10636526-10636548 AGCTACACCGGTGGGGTGACGGG - Intergenic
903031570 1:20467561-20467583 ACCCAGGGCTGGGGGCTGACTGG - Intergenic
903134902 1:21302962-21302984 GCCCAGGCCCGGGGGGTGGCAGG - Intronic
903186300 1:21631188-21631210 AGCCAGGCCAGGGGGTTGGATGG - Intronic
903243926 1:22002049-22002071 AGCCAGGTAGGGGGAGTGAGAGG - Intronic
903995111 1:27300693-27300715 AGCCAGGACAGGGGGGGGTCTGG + Intronic
904042383 1:27592375-27592397 TGACAGGCTGGGTGGGTGACAGG - Intronic
904300599 1:29550994-29551016 AACCTGGCCGGGTGGGTGACCGG + Intergenic
904457608 1:30657050-30657072 AACCTGGCCTGGTGGGTGACCGG - Intergenic
904466862 1:30713484-30713506 AGCCAGCCCGGGGGTGGGAGGGG - Exonic
904753180 1:32753912-32753934 GGCCAGGCCGGGGGCGGGCCCGG - Intronic
905146183 1:35888464-35888486 TGCCAGGCCGGCGAGGTGCCTGG - Exonic
906545457 1:46616658-46616680 AGCCAGGCGGGCGGGGTGCGCGG + Intronic
907390333 1:54153950-54153972 AGCCAGGCAGGGGTGGAGCCAGG - Intronic
907461469 1:54608084-54608106 AGCCAGGCTGGGGGCGTGGTTGG - Intronic
908780379 1:67685289-67685311 AGCAAGGCGGGAGGGGTGGCCGG + Exonic
913300684 1:117366762-117366784 AGCCAGGCTGGGTGGGGGAGGGG + Intergenic
913674695 1:121129952-121129974 ATCCAGGGCAGGAGGGTGACAGG - Intergenic
914026536 1:143917582-143917604 ATCCAGGGCAGGAGGGTGACAGG - Intergenic
914664916 1:149825013-149825035 ATCCAGGGCAGGAGGGTGACAGG - Intergenic
914670849 1:149868807-149868829 ATCCAGGGCAGGAGGGTGACAGG + Intronic
914758399 1:150579533-150579555 AGCCAGGCGGCGGCGGCGACTGG - Exonic
915349933 1:155217929-155217951 AGCCTGGCCCGGGGGGTGAAGGG + Intergenic
915353274 1:155239851-155239873 AGCCTGGCCCAGGGGGTGAGGGG + Intronic
915629056 1:157138058-157138080 AGCCCGGCCCGGGAGGTGAATGG - Intronic
915971079 1:160355767-160355789 AGCCAGGCTGGGTGGGAGCCTGG + Intronic
916108353 1:161446823-161446845 AGCCAAGCCGAGTGGCTGACGGG - Intergenic
916109940 1:161454203-161454225 AGCCAAGCCGAGTGGCTGACGGG - Intergenic
916111526 1:161461614-161461636 AGCCAAGCCGAGTGGCTGACGGG - Intergenic
916113112 1:161468994-161469016 AGCCAAGCCGAGTGGCTGACGGG - Intergenic
916481895 1:165221595-165221617 GGCCAGGCAGGGGGAGGGACCGG + Intronic
917738409 1:177940573-177940595 AGCCAGGGCGTTGGGGGGACTGG - Intronic
917901419 1:179546790-179546812 AGCCAGGCCTGGTGGTTGAGGGG - Intronic
919772358 1:201170848-201170870 AGACTGGACGGGGTGGTGACGGG - Intronic
919879267 1:201891471-201891493 AGCCAGGCTGTGGGGGTGCAGGG - Exonic
919957974 1:202438379-202438401 AGCCATGCCGCTGGGGGGACGGG - Intronic
923400774 1:233614071-233614093 AGCCAGGCCCGGGCGGGGGCGGG + Exonic
923886033 1:238157232-238157254 AGCCTGGCTGGGGAGGTGTCAGG + Intergenic
1063256832 10:4337723-4337745 AGCCAGGCCTGGTGGGTGTCTGG + Intergenic
1063372890 10:5533250-5533272 AGCCAGGCCAAGGCGGTGTCGGG + Intergenic
1067015887 10:42755959-42755981 AGCCAGGGCGGGGTAGGGACTGG - Intergenic
1067336969 10:45374152-45374174 AGCCAGACCGGGGCGGGGCCGGG + Intergenic
1067698520 10:48552471-48552493 ATCCAGGCTGGGTGGGTGAAGGG - Intronic
1069820612 10:71225384-71225406 AGCCAGGCATGGGAGGTGCCAGG - Intronic
1069894855 10:71673968-71673990 AGCCTGGCTGGGGTGGTGGCGGG + Intronic
1070162543 10:73874649-73874671 GGCCGGGCGGGGGGGGGGACTGG - Intergenic
1072784378 10:98269744-98269766 AGCCAGGCCTGGTGAGTGATTGG - Intergenic
1073509532 10:104034572-104034594 AGCAAGGCCTGCGGGGTGCCTGG + Intronic
1076136250 10:128047103-128047125 AGCCAGGCCGTGTGGGGGTCTGG + Intronic
1076217042 10:128703513-128703535 AGCCATGGCTGGGGTGTGACTGG + Intergenic
1076494784 10:130889896-130889918 GGCAAGGCCAGGGGTGTGACAGG + Intergenic
1076733925 10:132450493-132450515 AGTCAGGCTGGGGAGGGGACCGG - Intergenic
1080652905 11:34236697-34236719 AGCCAGGCCAGGAGGGAGACAGG + Intronic
1083263001 11:61533179-61533201 ACCCCGGCCTGGGGGGTGGCAGG + Intronic
1083324410 11:61866143-61866165 AGCCAGGCCGGGAGGGTCAGGGG - Exonic
1083677156 11:64332521-64332543 AGCCAGGCCGCTGGGGTGCCAGG + Intergenic
1084936581 11:72590150-72590172 AGACAGGACGGGGAGGTGGCCGG + Intronic
1086951078 11:92890738-92890760 AGACAGGCTGGGAGGGTGGCAGG - Exonic
1088786348 11:113185788-113185810 AGCCAGGTGAGGGGGGTCACTGG - Intronic
1091263679 11:134253828-134253850 AGCCAGGCCGGGGGGGTGACTGG - Intronic
1091356923 11:134944393-134944415 AGTCAGGCCGAGGTGCTGACAGG - Intergenic
1091406510 12:212882-212904 AGCCGGGACAGGGGGGTGAGGGG + Intronic
1092229995 12:6770847-6770869 CGCCAGGCCGGGGTGGGGCCGGG + Exonic
1094564995 12:31591042-31591064 AGCCCGGCCGGGTGGGGGAGGGG + Exonic
1095938657 12:47711596-47711618 AGCCAGGCCTGGGGGCAGACTGG - Intronic
1095955337 12:47802684-47802706 AGCCTGGCTGGGGGGATGGCTGG + Intronic
1100269537 12:93011462-93011484 AGCCAGGCCAGGTGGGTGGCTGG + Intergenic
1103317898 12:120071813-120071835 AGCCTCGCCTGTGGGGTGACAGG - Intronic
1104448786 12:128853409-128853431 CGCCAGGCGGGGAGGGGGACAGG - Intronic
1104685248 12:130780635-130780657 AGCCAGGGCAGGGAGGAGACAGG + Intergenic
1104799434 12:131543785-131543807 AGCCTGGCTGGGGAGGTGCCAGG + Intergenic
1104892839 12:132148665-132148687 GGCCAGGCCGGGGAGGGGGCGGG + Intronic
1104963598 12:132499302-132499324 AGCCAGGCAGGGGTGGTGCTGGG + Intronic
1110154283 13:72294983-72295005 AGCCATGTCGGGGGGCTGACGGG - Intergenic
1115985240 14:39098266-39098288 AACCAGGACGTGGGGGTGAGGGG + Intronic
1116051937 14:39814731-39814753 AGCCAGGTAGCGGGGGTGAGTGG + Intergenic
1117500402 14:56345474-56345496 AGACAGGCCGAGGGGGTGTGGGG + Intergenic
1118317666 14:64735569-64735591 AGCCAGGCTGGGTGGGTGCAGGG - Intronic
1119181062 14:72605601-72605623 AGACAGGCCGGGCTGGGGACAGG + Intergenic
1119615524 14:76096368-76096390 AGACAGGCCAGGGTGCTGACAGG + Intergenic
1119652986 14:76396891-76396913 AGCCAGGCCGAGGGAGTCGCTGG + Intronic
1119856683 14:77906352-77906374 AGCCAGGAGGGAGGGGTTACTGG - Intronic
1121279286 14:92687739-92687761 AGCCAGGCAGGGAGGGGGACGGG + Intronic
1121545980 14:94763994-94764016 AGCCAGGAGGTAGGGGTGACAGG - Intergenic
1121595130 14:95156908-95156930 CGCCAGGCCGGGGAGTGGACAGG + Intronic
1122082133 14:99273577-99273599 AGCCAGGCCTGGGGGCGGAGTGG - Intergenic
1122640325 14:103155814-103155836 AACCAGGCAGTGAGGGTGACAGG - Intergenic
1123052170 14:105549796-105549818 ACCCAGGCCTGGGGGGCGGCGGG - Intergenic
1124010906 15:25837852-25837874 AGCCAGGCAGTGGGGAAGACGGG + Intronic
1124249811 15:28099354-28099376 GGCCGGGCCGGGGGCGTGCCTGG - Exonic
1124971831 15:34496071-34496093 AACCAGGGCGGAGGGGAGACTGG - Intergenic
1126406563 15:48328880-48328902 AGCCAGGCATGGTGGGTGGCAGG - Intergenic
1127606220 15:60591513-60591535 AGCCGGGCCGGGGGCGGGAGGGG - Intronic
1128133717 15:65247632-65247654 AGACAGGCTGGGGTGGTGAGAGG - Intronic
1128509842 15:68306657-68306679 AGCCAGGGCAGGGGGATGCCAGG - Intronic
1129294944 15:74595057-74595079 AGCCAGGTGGGGTGGGTGACTGG - Intronic
1129385756 15:75195502-75195524 AGCCAAGCAGGGTGGGAGACTGG - Intergenic
1129608563 15:77036638-77036660 AGCCAGGCCAGGAGAGTGATGGG + Intronic
1131499561 15:92948684-92948706 AGCCAGGCGTGGGTGGTGGCGGG + Intronic
1131827234 15:96331395-96331417 AGGCAGGCCGGGGCGGAGGCCGG - Exonic
1132491548 16:234607-234629 AGCGAGGACGGAGGGGGGACGGG + Exonic
1132565549 16:620823-620845 AGCCCGTCGGGGGGGGTGGCTGG - Intronic
1132690656 16:1180564-1180586 AGCCAGGCCGTGGGGGGGCCAGG + Intronic
1132697619 16:1209017-1209039 AGGCTGGCCTGGGGGGTGGCGGG - Exonic
1132882871 16:2170164-2170186 AGCCAGGCCCGGGGGGCACCTGG + Intronic
1133022744 16:2974064-2974086 AGCCAGGCGGGGTGGCTGGCGGG + Exonic
1133044115 16:3076664-3076686 AGCCATGCTGAGTGGGTGACTGG + Intronic
1133141376 16:3747081-3747103 AGCCAGGCAGGGGGGCTTGCTGG - Intronic
1133916004 16:10110547-10110569 AGCCAGGACTGGGGGGTGCATGG + Intronic
1134827483 16:17296260-17296282 AGCAAGGCCTGGGGGGTGTTGGG + Intronic
1136553299 16:30993122-30993144 AGCAAGGCCCGGAGGGTGAGCGG - Exonic
1137810536 16:51348922-51348944 AGAGAGTTCGGGGGGGTGACGGG - Intergenic
1140477019 16:75244136-75244158 GGCCAGGCTGGTGGGGTGGCTGG - Intronic
1141643098 16:85352871-85352893 AGCTAGGCCAGGGGAGGGACTGG + Intergenic
1141647205 16:85373894-85373916 AGGGAGGCCGGGCGGGTGCCTGG - Intergenic
1141665507 16:85463347-85463369 AGCCAGACCGCGGGGGTCAAGGG - Intergenic
1142119617 16:88379506-88379528 GGCCAGGCCAGGGGAGGGACGGG + Intergenic
1142265621 16:89062870-89062892 AGCCAGGCCGCAGGGGTCAAAGG - Intergenic
1142349123 16:89571673-89571695 AGCCACGCCGGGGGCTGGACGGG + Intergenic
1143622678 17:8089860-8089882 AGGCAGGCCGTGGGGGCCACGGG - Intergenic
1144780741 17:17807239-17807261 AGCCAGGCGGTGGGGGGGGCGGG + Intronic
1144854113 17:18258602-18258624 AGCCGGGCCGGGCGCGTGCCGGG - Intronic
1145323012 17:21777513-21777535 AGCCATCCTGGGGGAGTGACTGG - Intergenic
1145722007 17:27082520-27082542 TGCCTGGCCGGGGAGGTGCCGGG - Intergenic
1145747842 17:27333129-27333151 AGCCAAGTCGGGGGGAAGACTGG + Intergenic
1147019329 17:37518781-37518803 AGACTGGCCGTGGGGATGACGGG + Exonic
1147388024 17:40093067-40093089 AGGCCGGCCGGGCGGGTCACTGG + Exonic
1147939468 17:44036121-44036143 AGGCAGGCCGGGGGAGGGAAGGG - Exonic
1147948459 17:44093517-44093539 AGCCAGGCCCGGGCGGGGATCGG + Intronic
1149501099 17:57153057-57153079 AGCCAGGCAGAGGCGGTGGCTGG + Intergenic
1149582020 17:57757254-57757276 AGCCAGGCTGTGGGTGTGACAGG - Intergenic
1149606915 17:57931609-57931631 AGCCAGTCCGAGGGTGAGACTGG + Intronic
1149865653 17:60149800-60149822 GGCCAGGCAGGGCGGGGGACCGG + Intergenic
1149995833 17:61405535-61405557 GGCCAGGCCGGGCAGGTGTCCGG - Exonic
1151671337 17:75573286-75573308 AGCCGGGCTGGGTGGGTGTCGGG + Intronic
1151833820 17:76570536-76570558 AGCCAGGCCGTGGTGGTGTGGGG - Intronic
1151907146 17:77056122-77056144 AGCCGGGCCGGGGAGCTGGCAGG + Intergenic
1152068900 17:78125640-78125662 AGCCTGGCCTGGGCGGTGGCTGG - Intronic
1152568960 17:81113090-81113112 AGCAAGGCCGCAGGGGAGACCGG - Intronic
1152710470 17:81868552-81868574 AGCCAGGCCTCGGGTGTGACGGG + Exonic
1152738095 17:82007296-82007318 AGCCAGGCCCTTGGGATGACGGG + Intronic
1152899226 17:82930457-82930479 AGCCAAGCCTGAGGGGTGGCAGG + Intronic
1154497741 18:14974902-14974924 AGTCAGGCCGAGGTGCTGACAGG + Intergenic
1155085258 18:22452187-22452209 AGCCAAGCTGGGGGTGAGACTGG - Intergenic
1160337034 18:78051262-78051284 AGCCAGGCAGGCATGGTGACGGG + Intergenic
1160423957 18:78767761-78767783 AGCCAGGCACGGGGTGTGAAGGG - Intergenic
1160830969 19:1104707-1104729 AGCCAGGAGGGGCGGGAGACGGG + Intronic
1160907780 19:1459934-1459956 AGCCAGGACCGAGGGCTGACAGG + Intronic
1160928161 19:1556734-1556756 AGCAAGGCCGGGGGTCTGCCCGG - Exonic
1160948455 19:1654369-1654391 TGCCAGGCCGGCGGGGAGGCGGG + Intergenic
1161149117 19:2697782-2697804 AGACGGGCGGGGGGGGGGACGGG - Intronic
1161201000 19:3014705-3014727 AGCCAGCCCTGGGGCATGACTGG + Intronic
1161296819 19:3524321-3524343 AGCCAGGCCGGGGTGTGAACGGG + Intronic
1161375390 19:3937177-3937199 ACCCAGGCCGGGGGTGAGGCAGG + Intronic
1162337860 19:10072825-10072847 ACCCAGGCCTGGGGGCTGAAGGG + Intergenic
1162536439 19:11265254-11265276 AGGCAAGCCAGGGAGGTGACAGG - Intergenic
1163337989 19:16686202-16686224 TGCCAGGGCAGGGGGGTGTCTGG + Intronic
1163617885 19:18340567-18340589 GGCGAGGCCGGGGGCTTGACAGG + Exonic
1166458518 19:42965480-42965502 AGCAAGGCAGGGTGGGTGATGGG + Intronic
1166677602 19:44748999-44749021 GGCCAGGCCGTGGGGGGGCCCGG - Exonic
1167085818 19:47309158-47309180 AGCCTGGCCGGGAGGCTGAGTGG + Intronic
1167376937 19:49117478-49117500 AGCCAGGCCAGGGAGGAGGCTGG + Intronic
1167453914 19:49588520-49588542 AGCCTGGCTGTGGGGCTGACAGG + Exonic
926008345 2:9389858-9389880 AGCCAGCCTGGGGGTTTGACAGG - Intronic
926056278 2:9775958-9775980 AGCCAGGCCTGGGGGTCGGCAGG - Intergenic
926321321 2:11750080-11750102 AGCGAGGCCGGGGAGGGGAGGGG - Intronic
926738144 2:16090019-16090041 AGCCAGGCTGTGGAGGTGGCTGG + Intergenic
926738163 2:16090115-16090137 AGCCAGGCTGTGGAGGTGGCTGG + Intergenic
926738182 2:16090211-16090233 AGCCAGGCTGTGGAGGTGGCTGG + Intergenic
926738201 2:16090307-16090329 AGCCAGGCTGTGGAGGTGGCTGG + Intergenic
926738221 2:16090403-16090425 AGCCAGGCTGTGGAGGTGGCTGG + Intergenic
927847809 2:26480390-26480412 AGACAGGCCGTGGGGGTGGATGG + Intronic
927880434 2:26686379-26686401 AGCCCAGCAGGGGGGGTCACAGG + Intergenic
927911891 2:26905580-26905602 AGCTAGGCCGGAGGGGTGGTAGG - Intronic
931044558 2:58336129-58336151 CACAAGGCCAGGGGGGTGACAGG + Intergenic
932337265 2:70938372-70938394 GGCCAGGCTGGGGAGGAGACAGG - Intronic
932337629 2:70939999-70940021 GGCCAGGCCGCTCGGGTGACCGG - Exonic
932375764 2:71234527-71234549 AGAGAGGCAGGAGGGGTGACTGG + Intergenic
934058189 2:88270030-88270052 AGCGAGGCAGGGGGAGTGACGGG + Intergenic
936409787 2:112247428-112247450 AGCCAGGCAAGGTGGGTGACAGG + Intronic
942136486 2:172931159-172931181 AGCCAGGCCGGGGTGGGGGGGGG + Intronic
942451755 2:176112544-176112566 AGCCTCGCCGGGGGGCTCACTGG - Intronic
942625579 2:177896658-177896680 AGTCAGGCAGTGGAGGTGACTGG + Intronic
944916348 2:204364589-204364611 AGCCAGGCCGAGGGAGTAAATGG - Intergenic
945039120 2:205729541-205729563 AGCCAGGCAGGGGTGGTCCCCGG + Intronic
947913667 2:233818584-233818606 AGCCACGAAGGGGGGGTGGCTGG + Intronic
948060560 2:235040833-235040855 GGCAAGGCCGGCGGGGTGTCCGG - Intronic
948261071 2:236604870-236604892 ATCCAGGCCTGGGGGATGAGGGG - Intergenic
948902220 2:240962559-240962581 AGCCAGGCCGGTCGGGGGCCTGG + Intronic
948997600 2:241591283-241591305 AACCAGGCCGGGGGCTTGAGAGG + Intronic
1171086566 20:22243480-22243502 ACCCAGGCCAGGGGGCTGCCTGG - Intergenic
1171180245 20:23086125-23086147 ACCCAGCCCGGGGCGGGGACGGG - Exonic
1172118797 20:32585713-32585735 AGCCAGGCCGGGAAGGTGTAGGG + Intronic
1172184556 20:33023267-33023289 AGCCAGGCTGAGGGGGCGGCTGG + Intronic
1172809459 20:37636996-37637018 TGGCAGGGCAGGGGGGTGACGGG - Intergenic
1173992747 20:47315804-47315826 AGCCAGCCGGGCGGGGTCACAGG - Intronic
1175371670 20:58496659-58496681 AGACAGGCCGGGAGGGTGCAGGG + Intronic
1175580524 20:60095367-60095389 AGCCAGGGCAGGGGGTGGACTGG + Intergenic
1175582696 20:60112758-60112780 AGCCAGGGAGGGGAGATGACAGG - Intergenic
1175642323 20:60641219-60641241 AACCAGGCCTGGAGGGAGACAGG + Intergenic
1175712059 20:61229213-61229235 AGCCAGGCCTGGGGAAGGACGGG + Intergenic
1175769227 20:61612795-61612817 AGCCAAGCCCTGTGGGTGACAGG - Intronic
1175995516 20:62810569-62810591 AGCCAGGCCTTGGCTGTGACTGG + Intronic
1176286692 21:5022459-5022481 AGCCAGGCCGGGGGCGGGGCGGG + Intergenic
1179112582 21:38460196-38460218 AGCCAGGGAGGAGGGGTTACTGG + Intronic
1179407945 21:41140709-41140731 AACCAGGCCGGGAGCGTGAGTGG - Intergenic
1179870489 21:44241016-44241038 AGCCAGGCCGGGGGCGGGGCGGG - Intergenic
1179957573 21:44749980-44750002 AGCCAAGTGGGGTGGGTGACTGG - Intergenic
1180183747 21:46129495-46129517 AGCCCGGCTGGGCGGGTGCCCGG - Intronic
1180622691 22:17172294-17172316 AGCCAGCCCGGGGTGGGGACTGG - Intergenic
1180977972 22:19860932-19860954 AGCCAGGGCAGGGAGGTGGCTGG + Intergenic
1181051878 22:20241813-20241835 AGGCAGGCAGCGGGGGTGGCGGG - Exonic
1181052903 22:20246139-20246161 AGCCAGGCCTGGGCTGAGACAGG - Intronic
1181523784 22:23466568-23466590 AGCAAGGCCAGGAGGGTGGCTGG - Intergenic
1181998875 22:26903960-26903982 AGCCAGGTCAGGAGGGTGAAAGG - Intergenic
1182315486 22:29444115-29444137 CCCCAGGCCGGAGGGGTGGCAGG + Intergenic
1182423187 22:30258218-30258240 AGGCAGGCAGGGCAGGTGACAGG + Intergenic
1183055835 22:35305052-35305074 AGCCAAGCCGGGGGAGCCACAGG + Intronic
1183811748 22:40263463-40263485 AGCCAGGCCTAGGTGGAGACTGG + Intronic
1184102700 22:42349110-42349132 AGCCAGGCCCTGGGGCTGCCTGG - Intergenic
1184448291 22:44567148-44567170 GGCCTGGCCGCGGGGATGACTGG + Intergenic
1184644224 22:45887740-45887762 AGCCAGGCCAGGCGGGTGCCTGG + Intergenic
1184651593 22:45921674-45921696 TGCCAGGCCGGGAGGGTGACAGG + Exonic
1184658649 22:45955226-45955248 GGCCAGGCCTGGGGTGTGGCAGG - Intronic
1185052198 22:48559739-48559761 AGCCAGGCAGGAGGGGCGGCGGG + Intronic
1185065075 22:48628059-48628081 AGCCAGGCTGGGGTGGGCACAGG + Intronic
950673064 3:14538814-14538836 GGCCAGGCCAGGGAGGAGACTGG + Intronic
952885374 3:38008497-38008519 AGCCAGGGCGCGGGGGTTAAAGG + Exonic
953546524 3:43867524-43867546 AGCAAGGGTGGGGGGGTGACTGG + Intergenic
953881322 3:46692856-46692878 AGCCAGGCCTGGGAGAGGACAGG - Intronic
953905043 3:46864478-46864500 AGCCAGGCCTGGGGTGTGTAGGG - Intronic
954706298 3:52482416-52482438 AGCCAGGCCCAGGGGCTGAGAGG + Intronic
956159635 3:66335698-66335720 AGGCAGGCAGGGGAGGTGTCTGG - Intronic
960925921 3:122795021-122795043 AGCCGGGCCGGCGGGGAGGCGGG - Exonic
961616705 3:128188354-128188376 AGGCAGGCTGAGGGGGTGGCAGG + Intronic
966928623 3:184661519-184661541 AGCCAGGCAGGCGTGGTGGCGGG - Intronic
973387660 4:49524273-49524295 AGCCAGGCCGGGGCAGGGTCTGG + Intergenic
975825834 4:78318810-78318832 AGCCAGGCAGGAGGAGTGACAGG - Exonic
977693785 4:99946270-99946292 GGCCAGGGCGGGGGTGTGTCGGG + Intronic
985496225 5:207990-208012 AGCCAGGCAGGGGAGGCTACAGG + Intronic
985660876 5:1155954-1155976 AGGGAGGCCGGGGGGGAGAGAGG + Intergenic
985928415 5:3035612-3035634 AGCCAGGCTGGCGTGGTGGCTGG - Intergenic
986233486 5:5886843-5886865 AGCAAGGCCTGGGGGATGGCAGG + Intergenic
987050648 5:14144415-14144437 ACCAAGGCCGGGGAGATGACAGG - Intronic
987085215 5:14461579-14461601 GCCCAGGCCTGGGGGCTGACTGG - Intronic
992379060 5:76219113-76219135 AGCCAGGACAGGCAGGTGACAGG + Intronic
997346174 5:133194015-133194037 AGCCAGGCAGGGAGGGAGTCGGG + Intergenic
998476975 5:142430205-142430227 AGCCAGGGCGGGCAGATGACCGG - Intergenic
999182034 5:149676493-149676515 AGACAGGTCAGGGTGGTGACAGG + Intergenic
999473139 5:151874059-151874081 AGCCAGGCTGGGGAAGGGACAGG + Intronic
1001618001 5:173057366-173057388 AGCCGGGCCGGGGGTGTTTCGGG + Intronic
1002275542 5:178102234-178102256 AGCCAGGCAGGCGCGGTGGCTGG + Intergenic
1002310820 5:178312704-178312726 AGCCAGGCCAGTAGGGTGAGAGG - Intronic
1003107412 6:3227249-3227271 AGGGAGGCCGAGGGGGTGACGGG + Intronic
1003149237 6:3534846-3534868 AGCCAGGAGGGTGGGGTGTCCGG - Intergenic
1006174812 6:32115519-32115541 AGCCAGGACTGGGGGTTCACAGG + Exonic
1006510301 6:34517741-34517763 AGCAAGGCAGGGGAGGGGACAGG - Intronic
1007615379 6:43176682-43176704 AGGCAGGGAGGGAGGGTGACAGG - Intronic
1011795498 6:90947725-90947747 AGCCAGGCTGTGGCAGTGACTGG - Intergenic
1014747201 6:125214108-125214130 AGCCTGGCAGGGAGGGAGACAGG + Intronic
1017002166 6:150004419-150004441 AGGGAGGCCTGTGGGGTGACAGG + Intergenic
1019151778 6:170011202-170011224 TGCCAGGCCGGGGCTGGGACCGG + Intergenic
1019155946 6:170038993-170039015 AGCCTGGCTGGGGTGGTGACTGG - Intergenic
1019261068 7:82317-82339 AGCCAGGCCCGGGCGGTGCCAGG - Intergenic
1019599648 7:1874886-1874908 GGCCAGGCCTGGGGTGTGGCCGG - Intronic
1022502037 7:30887757-30887779 AGCCTGGCCTGGGTGCTGACGGG + Intronic
1023990173 7:45124088-45124110 AGCCCGGCCAGGGGGGTGGTGGG + Intergenic
1025206375 7:56995687-56995709 GGCCAGGCCGGGGAGGGGGCTGG + Intergenic
1031604201 7:123748942-123748964 AGCCTGGCCGGGCGGGTGCCGGG - Exonic
1034445315 7:151111091-151111113 AGCCAGTCCTGGGGGGCGAAGGG + Intronic
1035310617 7:157965580-157965602 GGCCAGGCCTGAGGGGTGACTGG - Intronic
1035388885 7:158491881-158491903 AGCCAGGCAGAGGAGGTGAACGG + Intronic
1038447530 8:27614497-27614519 AGCCAGGGAGGGGAGGTGGCCGG - Intronic
1038488029 8:27950268-27950290 AGCCAGACCTGGGGGTTGCCAGG + Intronic
1039238089 8:35525089-35525111 AGGCAGGCCGGGGGAGGGAAGGG - Intronic
1042290908 8:67168300-67168322 AGGGAGGCCGTGGGGGAGACGGG + Intronic
1049224241 8:141442007-141442029 AGCAAGGCCCGGGGTCTGACTGG - Intergenic
1049610994 8:143555266-143555288 AGCCAGGCAGGGTGGGGGGCTGG + Intronic
1049611563 8:143558464-143558486 AGCCAGGCCGGGGGAGGGGGCGG - Intronic
1049664664 8:143837591-143837613 AGGCCGGCCCGGGGGGTGGCTGG - Intronic
1049694307 8:143976140-143976162 AGCGAGGCCGGGAGGGAGCCCGG + Intronic
1053288426 9:36864647-36864669 AGGCAGGCCGGTGGGCTGAGGGG - Intronic
1056450387 9:86710974-86710996 AGCCAGGCTGGGGGTCTTACAGG + Intergenic
1057797608 9:98169861-98169883 GGCCAGGAAGGTGGGGTGACAGG - Intronic
1058715028 9:107715893-107715915 AGCCAGGCCAGGGGGGACACAGG + Intergenic
1059346349 9:113631603-113631625 AGCCAGGCTGGAGGGGTCTCAGG + Intergenic
1059443824 9:114325908-114325930 AGCCAGACAGTGGGGGTGCCAGG - Intronic
1059557102 9:115292679-115292701 GGCAAGGCTGTGGGGGTGACAGG - Intronic
1061060114 9:128246042-128246064 GGCCAGGCCGGGGGTGAGAGAGG + Intronic
1061282731 9:129606873-129606895 AGCCAGGCAGGGGGGCTCCCTGG + Intergenic
1061858287 9:133455050-133455072 AGAGAGGCCGTGAGGGTGACAGG + Intronic
1062110699 9:134780595-134780617 AGCCAGGCAGGGAGGGAGAGAGG + Intronic
1062284605 9:135767518-135767540 AGCCAGGCCAGGGAGCGGACAGG + Intronic
1062436978 9:136550713-136550735 AGCTGGGCCTGGGGGGTGGCTGG + Intergenic
1062445958 9:136594854-136594876 TGCCAGGCTGGGGAGGGGACGGG + Intergenic
1062629717 9:137458359-137458381 AGCCAGGCCGGCAGGGCGCCGGG + Intronic
1062696972 9:137880506-137880528 AGCCAGGCCGGGGCGGGGGCAGG + Intronic
1185763949 X:2709125-2709147 AGCTAGGCTGGGGAGGTGGCAGG + Intronic
1186185048 X:7012542-7012564 AGCAAGGCAGGGTGGGTGATGGG + Intergenic
1187389911 X:18879101-18879123 AGCCTGGCCTAGGGGGTGGCTGG + Intergenic
1189298944 X:39938171-39938193 TGCCAGGCCGTGGGGGTCAGTGG - Intergenic
1190279331 X:48918915-48918937 AGCCAGGGCTGGGGGGCGCCAGG + Exonic
1192124880 X:68492762-68492784 AGCAAGGGTGGGGAGGTGACAGG + Intergenic
1192892677 X:75407457-75407479 GGCCAGGCGGGGTGGCTGACCGG - Intronic
1200092540 X:153642642-153642664 AGCCAGGCCGGGTGGGGGGTGGG - Intronic