ID: 1091263681

View in Genome Browser
Species Human (GRCh38)
Location 11:134253836-134253858
Sequence GAGTAGGGAGCCAGGCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 452}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091263681_1091263693 -1 Left 1091263681 11:134253836-134253858 CCCCCCGGCCTGGCTCCCTACTC 0: 1
1: 0
2: 1
3: 35
4: 452
Right 1091263693 11:134253858-134253880 CCGGCCGGTCACCCCCGGCCTGG 0: 1
1: 2
2: 3
3: 9
4: 176
1091263681_1091263706 30 Left 1091263681 11:134253836-134253858 CCCCCCGGCCTGGCTCCCTACTC 0: 1
1: 0
2: 1
3: 35
4: 452
Right 1091263706 11:134253889-134253911 TCCGGTCGGTCACCACCATCCGG 0: 1
1: 0
2: 0
3: 2
4: 33
1091263681_1091263698 12 Left 1091263681 11:134253836-134253858 CCCCCCGGCCTGGCTCCCTACTC 0: 1
1: 0
2: 1
3: 35
4: 452
Right 1091263698 11:134253871-134253893 CCCGGCCTGGCTGCCCCCTCCGG 0: 1
1: 0
2: 6
3: 149
4: 2064
1091263681_1091263700 16 Left 1091263681 11:134253836-134253858 CCCCCCGGCCTGGCTCCCTACTC 0: 1
1: 0
2: 1
3: 35
4: 452
Right 1091263700 11:134253875-134253897 GCCTGGCTGCCCCCTCCGGTCGG 0: 1
1: 0
2: 1
3: 53
4: 393
1091263681_1091263691 -6 Left 1091263681 11:134253836-134253858 CCCCCCGGCCTGGCTCCCTACTC 0: 1
1: 0
2: 1
3: 35
4: 452
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091263681 Original CRISPR GAGTAGGGAGCCAGGCCGGG GGG (reversed) Intronic
900068045 1:747078-747100 GGGTAGGGGGCCAGGCATGGTGG + Intergenic
900224601 1:1527087-1527109 GACTAGGGAGCCTGGCCATGGGG - Intronic
900330053 1:2129626-2129648 CTGTGGGGAGCCAGGCAGGGGGG + Intronic
900419803 1:2551012-2551034 GTGAAGGGAGCCAGGCCCCGAGG - Intergenic
900420156 1:2552785-2552807 GAGCTGGGGGCCAGGCCAGGGGG - Intergenic
900424275 1:2568873-2568895 GAGCTGGGGGCCAGGCCAGGGGG + Intergenic
900425170 1:2575026-2575048 GTGAAGGGAGCCAGGCCCCGAGG + Intergenic
900565977 1:3332036-3332058 GAGCAGGGAGCCTGGCAGGGTGG - Intronic
900624525 1:3602191-3602213 GAGGAGGGGCCCAGCCCGGGAGG - Intronic
901242636 1:7704249-7704271 GCGCGGGGAGCCAGGCAGGGCGG + Intronic
901242895 1:7705053-7705075 GTGTGCGGGGCCAGGCCGGGAGG + Intronic
901769009 1:11521229-11521251 GAGGAGTTAGCCAGGCTGGGAGG + Intronic
901811909 1:11772176-11772198 CAGTAGAGTGCCAGGCCTGGGGG - Exonic
902234286 1:15047799-15047821 AGGTGGGGAGCCAGGCCCGGGGG + Intronic
902605309 1:17565853-17565875 GAGGAGGCAGCCAGGGAGGGAGG - Intronic
902779977 1:18698768-18698790 GAGGAGGCAGCCAAGCCTGGAGG - Intronic
902798658 1:18815884-18815906 GAGGTGGGAGCCAGGGCTGGGGG - Intergenic
903130896 1:21279060-21279082 AAGGAGGGAGCCAGGCCCAGGGG - Intronic
903499022 1:23791681-23791703 GAGGAGGGAGCCTGGGCGGGAGG + Intronic
903573342 1:24322203-24322225 GAGCAGGGAGCGAGGCCGCGGGG - Intronic
903633845 1:24799126-24799148 GACTAGGCAGCCAGGCAGAGGGG - Intronic
903824518 1:26133576-26133598 GAGTAGGCAGCCAGGTGTGGTGG + Intergenic
904030050 1:27528060-27528082 GAGGAGGGAGCCCGGCCGGCAGG + Intergenic
904971679 1:34424053-34424075 GAGTGGGGAGACAGGAAGGGAGG - Intergenic
905356163 1:37386404-37386426 GACTAGGGAGGCAGGGCGGTGGG - Intergenic
906152995 1:43598682-43598704 GAGAAGGAAGTCAGGCCTGGAGG - Intronic
906203034 1:43972022-43972044 AGGTGGGGAGCCAGGCCTGGAGG - Exonic
906741881 1:48192222-48192244 GACTAGGCAGCCAGGCAGAGGGG - Intergenic
907089711 1:51711927-51711949 GACTAGGCAGCCAGGCAGAGGGG + Intronic
907216084 1:52865226-52865248 GGGGAGGGAGCCAGGCATGGTGG - Intronic
907402376 1:54233061-54233083 GAGTGGGCAGCCAGGCAGAGGGG - Intronic
907453878 1:54562921-54562943 GAGTGGGCAGCCAGGCAGAGGGG + Intronic
907581648 1:55577802-55577824 GTGTATGGAGCCAGGCTGGGCGG + Intergenic
907814845 1:57908420-57908442 GAGAAGAGAGCCAGGGAGGGAGG + Intronic
910714288 1:90214321-90214343 GAATAGGAAGCCAGGGAGGGAGG - Intergenic
912316907 1:108675551-108675573 GACTAGGCAGCCAGGCAGAGGGG - Intergenic
913356595 1:117929421-117929443 GAGGAGGGACTGAGGCCGGGAGG - Intronic
913703747 1:121397710-121397732 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
913980098 1:143499419-143499441 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
914074446 1:144324904-144324926 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
914104730 1:144641542-144641564 GAGTTGGGAGTCAGACCTGGAGG - Intergenic
915208316 1:154287401-154287423 GACTAGGCAGCCAGGCAGAGGGG - Intergenic
915668859 1:157470379-157470401 GAGAAGGGAGGCAGGCTGTGGGG - Intergenic
915979252 1:160409911-160409933 GATTAGGGAGCCAGGCAGCTAGG + Intronic
916058927 1:161085970-161085992 GAGGAGGGGGCCAGGCGTGGTGG - Intronic
916493640 1:165325929-165325951 GAGGAGGCAGGCAGGCCCGGGGG - Intronic
920377647 1:205517810-205517832 GAGCAGGGAGCCCGGGCAGGAGG - Intronic
921121376 1:212140439-212140461 GAGTAGAGGGCCAGGCGTGGTGG - Intergenic
922038612 1:221874033-221874055 GGGTAGGAAGGCAGGCAGGGAGG + Intergenic
922469988 1:225870450-225870472 GTGTAGGGAGCCAGGAGGCGGGG - Intronic
922775810 1:228213802-228213824 GAGGGGGGAGCCAGGCCGCACGG + Intronic
924242880 1:242057267-242057289 GAGCTGGGAGCCTGGCCAGGCGG + Intergenic
1062932549 10:1362793-1362815 GAGGAGACAGCGAGGCCGGGTGG - Intronic
1064025869 10:11848454-11848476 GAGTGGGGGGCCAGGCACGGTGG - Intronic
1064117673 10:12592905-12592927 GAGGAGGGAGCCAGGCAGAAAGG - Intronic
1067227434 10:44385125-44385147 GAGGGGAGAGCCAGGCGGGGCGG + Intronic
1068089117 10:52411042-52411064 GGGAGGGGAGCCAGGCCGGCTGG - Intergenic
1070282889 10:75062669-75062691 GAGTTGGGAGCCATGCAGAGAGG - Intergenic
1070623332 10:78030923-78030945 GTGTAGGCAGCCAGGCGTGGTGG + Intergenic
1070768510 10:79069588-79069610 GTGTAGGGAGCGAGGGCTGGAGG - Intronic
1071417087 10:85451464-85451486 GAGGTGGGAGACAGGCGGGGTGG - Intergenic
1071973998 10:90936917-90936939 GAGTAGCGAGCCTGGCCATGAGG - Intergenic
1072013532 10:91323804-91323826 GACTGGGCAGCCAGGCAGGGGGG + Intergenic
1072064272 10:91850429-91850451 TAGAAGGGAGCCAGGCACGGTGG + Intronic
1072738468 10:97895469-97895491 GAGCAGGGAGCCAGGGAGGACGG + Intronic
1074046576 10:109844847-109844869 GAGAAGGGAGCAAGGGTGGGAGG + Intergenic
1074409769 10:113217216-113217238 GAGCAAGGAGCCAGGCATGGTGG - Intergenic
1074498741 10:114003091-114003113 GAGTAGGGAACCAAGCACGGTGG - Intergenic
1074610550 10:115017089-115017111 GTGCAGGGAGCCAGGCTGGGTGG + Intergenic
1075220624 10:120581373-120581395 AAGGAGGGAGCCAGGCTGAGAGG - Intronic
1077169050 11:1158336-1158358 GTGCAGGGATCCGGGCCGGGAGG - Intronic
1077433434 11:2527016-2527038 GAGGCGGGAGGAAGGCCGGGCGG + Intronic
1078484038 11:11705519-11705541 GAGCAGGGAGCGAGGCTGCGTGG + Intergenic
1079018264 11:16887875-16887897 GACTAGGCAGCCAGGCAGAGGGG - Intronic
1080588322 11:33700484-33700506 CTGGAGGGACCCAGGCCGGGTGG + Exonic
1083296658 11:61718803-61718825 GGATAGGGAGGCGGGCCGGGCGG + Intronic
1083300286 11:61736479-61736501 GGGTTGGGAGCCAGGCTGGAAGG - Intronic
1083324414 11:61866151-61866173 GAGAGTGAAGCCAGGCCGGGAGG - Exonic
1083332307 11:61904667-61904689 GACCAGGGAGGCAGGCAGGGTGG + Intronic
1083732013 11:64657404-64657426 GAGTTTGGAGCCAGGCCTGGGGG - Intronic
1083798954 11:65035221-65035243 GAGGAGGGAACCAGGGCTGGAGG + Intronic
1083831970 11:65239099-65239121 GACTAGGCAGCCAGGCAGAGGGG - Intergenic
1084196321 11:67525094-67525116 GAGGAGGGAGGGAGGCAGGGAGG - Intergenic
1084303036 11:68263777-68263799 GAGCTGGGAGCAAGGCTGGGCGG + Exonic
1084924888 11:72503055-72503077 GACTAGGCAGCCAGGCAGAGGGG + Intergenic
1085197888 11:74683360-74683382 GGGTAGCGAGCGCGGCCGGGCGG + Intergenic
1085423160 11:76380912-76380934 GGGAGGGGAGCCAGGCCGGCCGG + Exonic
1085465441 11:76720134-76720156 GATTGGGCAGACAGGCCGGGAGG - Intergenic
1086644624 11:89204286-89204308 TAGTGGGGAGCCAGGTCGGTGGG + Intronic
1088478901 11:110273565-110273587 GAGTTTGGAGCTAGGCCTGGCGG - Intronic
1089174610 11:116539464-116539486 GAGAAAGAAGCCAGGCTGGGAGG + Intergenic
1089350699 11:117820119-117820141 GAGGAGGGAGACAGGCAGGCAGG + Exonic
1089455070 11:118621331-118621353 GGGAAGGGAGCCAGGGAGGGAGG - Intronic
1089496556 11:118911163-118911185 GAGGGGGGAGCCAGGGCTGGGGG - Intronic
1089662622 11:119995483-119995505 GAGCAGGGAACCTGGCCTGGTGG - Intergenic
1089876084 11:121723244-121723266 GAGTAGGGGGCCGGGTGGGGAGG - Intergenic
1090669452 11:128936161-128936183 GAGCATGGAGCCAGGCTGCGGGG - Intronic
1091263681 11:134253836-134253858 GAGTAGGGAGCCAGGCCGGGGGG - Intronic
1091306766 11:134541413-134541435 AAGCAGGGAGCCTGGCCAGGAGG + Intergenic
1092197055 12:6555875-6555897 GAGTAGGCAGCAGGGCCGGCCGG + Exonic
1092344366 12:7703263-7703285 CAGTATGGAGCCAGGCGCGGTGG - Intergenic
1094564988 12:31591034-31591056 GGGTCCGGAGCCCGGCCGGGTGG + Exonic
1094674558 12:32606554-32606576 GACTAGGGAGCGAGCCCAGGAGG - Intronic
1096798430 12:54093088-54093110 GAGGAGGGAGGCAGGAAGGGAGG + Intergenic
1097205527 12:57317702-57317724 GAGGAACGGGCCAGGCCGGGTGG + Intronic
1097779487 12:63686639-63686661 GAGTGGGCAGCCAGGCAGAGGGG - Intergenic
1098050251 12:66445711-66445733 GAGTAGGGAGCCAGGGTGCAGGG - Intronic
1099989628 12:89708804-89708826 GAGTAGGGAGCCCCGGCTGGTGG - Exonic
1100329636 12:93571520-93571542 GAGGAAGGAGCGAGGGCGGGAGG - Intronic
1102243657 12:111341622-111341644 GAGGAGGGAGAAAGGCTGGGGGG + Intronic
1102375585 12:112418915-112418937 GAGGAGCGAGCCGGGCCGGGGGG + Exonic
1102692197 12:114770151-114770173 AAGTAAGGAGCCAGGCAGGGTGG - Intergenic
1102764818 12:115423279-115423301 GAGTGGGGAGGGAGGCAGGGAGG + Intergenic
1102954915 12:117053033-117053055 GAGGAGGGAGCTAGGCAGGAAGG - Intronic
1103506365 12:121444219-121444241 GAGCAGGGAGCCGGGCAGGTTGG + Exonic
1103562844 12:121801033-121801055 GAGGAGCGAGCGCGGCCGGGAGG + Intronic
1104049461 12:125186190-125186212 GGGGAGGGCGCCCGGCCGGGAGG - Intergenic
1104249572 12:127078974-127078996 TGTTAGGGAACCAGGCCGGGAGG + Intergenic
1104343751 12:127977200-127977222 GAGAAGAGAGCCAAGCCGGGTGG - Intergenic
1104674981 12:130706433-130706455 GAGTCTGGAGCCAGGCTGGCAGG - Intronic
1105058911 12:133130097-133130119 CAGCAGGGAGCCTGCCCGGGAGG - Intronic
1105917903 13:24934011-24934033 GAGGAGGGGGCCAGGCACGGTGG - Intergenic
1106192606 13:27466759-27466781 GAGGGTGGAGACAGGCCGGGTGG + Intergenic
1106947059 13:34840269-34840291 AAGAAGGGAGGGAGGCCGGGAGG + Intergenic
1112056249 13:95691569-95691591 GACTAGGCAGCCAGGCAGAGGGG + Intronic
1112441137 13:99426004-99426026 GTGTAGGGATCCAGGCCAGAGGG - Intergenic
1113425751 13:110207113-110207135 GAGGAGGGAGCTGGGCTGGGGGG - Intronic
1113775213 13:112940495-112940517 GGGTAGGGAGCTGGGCCAGGCGG - Intronic
1113894457 13:113754872-113754894 GGGCAGGGAGCCAGGCCGCTCGG - Intergenic
1113922027 13:113918646-113918668 AAGTGGGGAGCCTGGCCAGGTGG - Intergenic
1113973822 13:114211504-114211526 GAGCAGGGTCCCAGGCGGGGAGG - Intergenic
1113973840 13:114211553-114211575 GAGTGGGGTCCCAGGCAGGGAGG - Intergenic
1114500397 14:23164123-23164145 GAGAAGGGAGCTAGGCATGGTGG - Intronic
1118905523 14:70020638-70020660 CAGCTGGGAGCCAGGCAGGGTGG + Intronic
1119262171 14:73244416-73244438 GAGCTGAGAGCCAGGCCTGGAGG - Intronic
1119517279 14:75258196-75258218 GAGGAGAGGGCCAGGCAGGGTGG - Intronic
1119752563 14:77090237-77090259 GAGGAGGAAGCCAGGCACGGTGG + Intergenic
1119757599 14:77129905-77129927 GAGTAGGGACCCAAGCAGAGAGG - Intronic
1121262112 14:92573955-92573977 GAGCGGAGAGCCAGGCCTGGCGG + Intronic
1122047714 14:99035483-99035505 GAGGACAGAGCCAGGCTGGGAGG + Intergenic
1122557897 14:102591630-102591652 GAGTAGGGAGGCGGGGCGGGCGG + Intergenic
1122790207 14:104181183-104181205 GGGCAGGGAGCCAGGCTTGGGGG + Intergenic
1122816341 14:104316009-104316031 GAGTGGGGAGTGGGGCCGGGTGG + Intergenic
1122909375 14:104819607-104819629 TAGTAAGGAGGCAGGCAGGGTGG + Intergenic
1122947401 14:105019021-105019043 GAGCAGGGGGCCAGGCATGGTGG - Intronic
1123059321 14:105587337-105587359 GGGTAGAGAGCCAGGTCAGGGGG + Intergenic
1123083653 14:105707568-105707590 GGGTAGAGAGCCAGGTCAGGGGG + Intergenic
1124690236 15:31815679-31815701 CAGGATGGAGCCAGGCTGGGGGG + Intronic
1124900569 15:33818834-33818856 GTCTAGGGAGCCAGGCGTGGTGG + Intronic
1124971833 15:34496079-34496101 GAGTAGGGAACCAGGGCGGAGGG - Intergenic
1125500861 15:40239685-40239707 GAGTTCAGAGCCAGCCCGGGAGG - Exonic
1125634621 15:41176855-41176877 GGGTAGGGGGCCAGGCGTGGTGG - Intergenic
1126113108 15:45187177-45187199 AAGTGGAGAGCCAGCCCGGGAGG + Intronic
1126125380 15:45290770-45290792 GAGTGGTGAGCCAGGCATGGTGG - Intergenic
1127450593 15:59112630-59112652 GAGGAGGCGGCCAGGCCTGGTGG - Intronic
1127731011 15:61801987-61802009 GATTAGGGAGCCTGGGTGGGTGG - Intergenic
1128353954 15:66911431-66911453 GAGGCTGGAGCCAGGCCTGGAGG - Intergenic
1129666602 15:77582802-77582824 GAGTGGGGAGCCAGGCTGGTGGG - Intergenic
1129976257 15:79824600-79824622 GAGTGGGGAGCCAGCCCAGCAGG - Intergenic
1131055302 15:89371338-89371360 GCGGAGGGAGCCTGGCCAGGAGG + Intergenic
1131466120 15:92655883-92655905 CAGCCGGGACCCAGGCCGGGTGG - Exonic
1132094985 15:98977055-98977077 GAGTATGGAACCAGGCCTGGAGG + Intronic
1132216381 15:100064682-100064704 GAGTAGGGGGCCAGGACGGCAGG + Intronic
1132242357 15:100267670-100267692 GAGAAGGGAGACAGGGAGGGGGG - Intronic
1132250831 15:100334578-100334600 GAGTCGGGGGGCAGGACGGGAGG - Intronic
1132668910 16:1094811-1094833 GTCCAGGGGGCCAGGCCGGGCGG + Exonic
1133022741 16:2974056-2974078 GGGTGGTGAGCCAGGCGGGGTGG + Exonic
1133055266 16:3142632-3142654 GAGCAGGGAGCCAGTACCGGTGG - Exonic
1133220479 16:4317266-4317288 GAGGGGGCAGCCAGGCCGGCTGG + Intronic
1133752165 16:8733346-8733368 GACTGGGCAGCCAGGCCGAGGGG + Intronic
1134228830 16:12413480-12413502 GAGAAGGGAGCCAGGTGAGGTGG + Intronic
1134290785 16:12901805-12901827 GAGGAGCGCGCCCGGCCGGGCGG - Exonic
1135730675 16:24892546-24892568 GGGCAGGGAGGCAGGGCGGGTGG + Intronic
1136143893 16:28304255-28304277 GGATAGGGAGCCAGGCACGGAGG - Intronic
1136556572 16:31010685-31010707 GAGGAGGAAGCGAGGGCGGGGGG + Intergenic
1136590559 16:31215510-31215532 GAGCAGGGAGCCAGCCCGAACGG - Intronic
1136699416 16:32117334-32117356 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
1136768231 16:32810600-32810622 GAGTTGGGAGTCAGACCTGGAGG - Intergenic
1136799908 16:33060505-33060527 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
1136868072 16:33771655-33771677 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
1136902321 16:34051765-34051787 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
1136957808 16:34804515-34804537 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
1138034193 16:53586368-53586390 GATAATGGAGCCAGGCCTGGTGG - Intergenic
1139398244 16:66658258-66658280 AAGGAGGGAGGCAGGCAGGGAGG + Intronic
1139517163 16:67458922-67458944 GAGTAGGGAGCCAAGATGTGGGG - Intronic
1139649747 16:68356329-68356351 GGGCAGGCAGCCAGGCAGGGCGG + Intronic
1140078417 16:71723254-71723276 GGGTTCGGGGCCAGGCCGGGTGG - Intronic
1140658696 16:77166383-77166405 GAGTAAGGGGCCAGGCGTGGTGG + Intergenic
1141435838 16:83999252-83999274 GAGTAAGTAGCCAGGATGGGGGG + Intronic
1141500872 16:84443307-84443329 GAGGAGGGACCCAGGCCAAGTGG - Intronic
1141594629 16:85089665-85089687 GAGGAGGTAGCCAGGAAGGGCGG - Exonic
1141647207 16:85373902-85373924 GAGCGGGGAGGGAGGCCGGGCGG - Intergenic
1141692089 16:85602238-85602260 GAGGCGGGGGCCAGGCAGGGAGG + Intergenic
1141831606 16:86512388-86512410 GAGGCAGGAGCCAGGCCTGGAGG + Intronic
1142123962 16:88401023-88401045 GTGGAGGGAGCCAGGCTTGGTGG - Intergenic
1203070623 16_KI270728v1_random:1072616-1072638 GAGTTGGGAGTCAGACCTGGAGG - Intergenic
1203104102 16_KI270728v1_random:1344621-1344643 GAGTTGGGAGTCAGACCTGGAGG - Intergenic
1203129412 16_KI270728v1_random:1617747-1617769 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
1143021102 17:3917583-3917605 GGGCAGGGAGCCAGGCCCTGGGG + Intergenic
1143124428 17:4632436-4632458 GAGTGGGGAGCTCTGCCGGGAGG + Intronic
1143871886 17:9962850-9962872 GAGTAGGGTGCCAACCTGGGTGG + Intronic
1144998762 17:19288965-19288987 GAGCAGGGAGCCAGGTCAGGAGG + Intronic
1145766836 17:27464035-27464057 GAGTTGGGAGTCAGACCTGGAGG + Intronic
1145974994 17:28978767-28978789 GAGTAGGGAGCAAGTGTGGGCGG + Intronic
1145978085 17:28995908-28995930 GAGGAGGGAGGCATGCCTGGAGG - Intronic
1145979840 17:29005035-29005057 GGGCAGGAAGGCAGGCCGGGAGG + Intronic
1146367933 17:32244088-32244110 GAGGAGGGAGCCAGGCGCGGTGG + Intronic
1146382580 17:32341917-32341939 GGGTGGGGTGCAAGGCCGGGCGG + Intronic
1146922489 17:36722813-36722835 GAAGAGGCAGCCAGGCAGGGTGG + Intergenic
1147283910 17:39385742-39385764 GATTAGGCAGCCAGGCGAGGTGG + Intronic
1147443761 17:40462661-40462683 AAGTAGAGAGCCAGGGTGGGTGG + Intergenic
1148054607 17:44786733-44786755 AAGGAGGTAGCCAGGCCTGGAGG - Intergenic
1148455196 17:47807731-47807753 GAGAAGGGATCCAGGACAGGAGG + Exonic
1148668178 17:49390331-49390353 GAATAGAGAGCCATGCTGGGTGG + Intronic
1148800379 17:50221260-50221282 GAGTGGGCAGCCAGGCAGAGCGG - Intergenic
1149309757 17:55382541-55382563 GTGAAGGAAGCCAGGCCTGGGGG + Intergenic
1150812008 17:68364012-68364034 GTGGAGGGAGGCAGGCCTGGAGG - Intronic
1150927865 17:69553061-69553083 GAATAGGGACCCAGGACAGGTGG - Intergenic
1151658590 17:75507197-75507219 GAGTACGGAGCCAGCCCAGCTGG + Intronic
1151716985 17:75835987-75836009 GAGCAGATAGCCAGGTCGGGAGG - Intronic
1151868528 17:76820838-76820860 GAGTAGGAAGCCATGCGGTGTGG + Intergenic
1152312282 17:79558591-79558613 GTGCATGGAGCCCGGCCGGGAGG - Intergenic
1152354345 17:79799387-79799409 GGGTAGGGCGCGAGGCCAGGCGG - Intronic
1152431880 17:80252849-80252871 GAGAAGGAAGCCAGGCCTGGAGG + Exonic
1152463874 17:80455078-80455100 CAGTAAGGAGCCAGGCGGCGGGG - Intergenic
1152923977 17:83079391-83079413 GAGGAGGGGGCCGCGCCGGGCGG - Intergenic
1153051713 18:907314-907336 GGCTCGGGAGCCAGGCGGGGAGG + Intronic
1154138629 18:11802928-11802950 GAAGAGTGAGCCAGGCTGGGTGG + Intronic
1154329504 18:13418131-13418153 GAGAAAGGAGCCAGCCTGGGAGG - Intronic
1154518148 18:15197117-15197139 GAGTTGGGAGTCAGACCTGGAGG - Intergenic
1155021084 18:21897627-21897649 GAGGAGGGAAGCAGGCAGGGAGG - Intergenic
1155109703 18:22702148-22702170 GAGCTGGGAGCCAGGCCCGCGGG - Intergenic
1155630536 18:27887525-27887547 GAGGAGGGAGGCAGGGAGGGAGG - Intergenic
1156345482 18:36253378-36253400 GAGTAGGAGGCCAGGCGCGGTGG + Intronic
1156469452 18:37368307-37368329 GAGTAGGGAGACGGGCAGGGAGG - Intronic
1158878595 18:61754980-61755002 GAGTAGAGAAAGAGGCCGGGCGG - Intergenic
1160510268 18:79449658-79449680 CAGGATGGAGCCAGGCCGGAGGG + Intronic
1160831093 19:1105144-1105166 GAGCAGGGAGCGTGGACGGGAGG - Intronic
1161536233 19:4820435-4820457 AAGTTTGGAGCCAGGCCTGGTGG + Intronic
1162145245 19:8609323-8609345 GGGGAGGGTGCCAGGCCTGGAGG + Intronic
1162461271 19:10815749-10815771 GGGAAGAGAGCCAGGCAGGGCGG - Intronic
1163386289 19:17002122-17002144 GAGGAGGGAACCAGGAAGGGAGG + Intronic
1165425751 19:35744601-35744623 GAGTAAGGGACCAGGCCTGGGGG - Intronic
1165438828 19:35812335-35812357 GAGTAGGGAGCCAGGGCCCAGGG - Intronic
1165768372 19:38364436-38364458 GAGTGGGCAGCCAGGCAGAGGGG + Intronic
1165914282 19:39248214-39248236 CAGAAGGGAGCCCTGCCGGGAGG - Intergenic
1166343274 19:42151053-42151075 GAGCAGGGGGCCAGGTAGGGGGG - Intronic
1166956380 19:46468188-46468210 GAGGAGGGAGCAAGGCGTGGGGG + Exonic
1167600092 19:50449829-50449851 GTGTAGGGAACCATGCCGGCTGG + Intronic
1167604815 19:50476103-50476125 GAGAGGGGAGCCAGGCCTAGAGG - Intronic
1168293948 19:55369853-55369875 GAGTAGCGACCCCAGCCGGGGGG - Intronic
1202680047 1_KI270712v1_random:2051-2073 GAGTTGGGAGTCAGACCTGGAGG - Intergenic
925695307 2:6571039-6571061 GAGTAGGGAGGCAGGCAGTTTGG - Intergenic
926210060 2:10862855-10862877 GAGCAGGGAGGCCGGCTGGGAGG + Intergenic
928137219 2:28696630-28696652 GAGCTGGGAGCCAGGCATGGTGG + Intergenic
928170054 2:28997898-28997920 GAGGAGGCAGCCAGGCTGAGAGG + Intronic
928219493 2:29391663-29391685 GAGGAGGGAGACAGGGAGGGAGG - Intronic
930031125 2:47058685-47058707 GAGTGGGCAGCCAAGCCTGGGGG + Intronic
930094874 2:47559330-47559352 GAGTGGGGAGCCCAGCAGGGAGG + Intronic
930834033 2:55774256-55774278 GACTAGGCAGCCAGGCAGAGGGG + Intergenic
931300657 2:60974866-60974888 GCGTAGCGTGCCAGGCCGAGTGG + Intronic
932201227 2:69829950-69829972 GCGCAGGGTGCCAGGGCGGGGGG + Exonic
932471415 2:71961938-71961960 GAGCAGGGAGTGAGGCCGGTAGG - Intergenic
933447946 2:82405626-82405648 GAGTAAGAAGTCAGGCCGGGAGG + Intergenic
933709945 2:85317464-85317486 AAGCAGGCAGCCAGGCTGGGAGG + Intergenic
934251428 2:90359384-90359406 GAGTTGGGAGTCAGACCTGGAGG - Intergenic
934258132 2:91444014-91444036 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
934474911 2:94587412-94587434 GAGTGGGGCTCCAGGCAGGGTGG + Intergenic
934715685 2:96542013-96542035 GAGCTGGGAGCCAGGCAGGCAGG - Intronic
935117373 2:100147927-100147949 GAGTAAGGGGCCAGGCGTGGTGG + Intergenic
935702990 2:105829010-105829032 GAGTAGAGTGCCAGGCCTAGGGG + Intronic
938518061 2:132037364-132037386 GAGTTGGGAGTCAGACCTGGAGG - Intergenic
938694945 2:133826541-133826563 GAGAAGGGAAGCAGGCAGGGAGG + Intergenic
938960502 2:136336279-136336301 GAGTTGGGAGGCAGGCAGGGTGG + Intergenic
939395341 2:141622176-141622198 GAGTAATGAGCCAGGCGCGGTGG - Intronic
940656094 2:156489739-156489761 GAGAAGGGAGCGAGGGAGGGAGG - Intronic
942566066 2:177265243-177265265 GGGAAGGGAGCAAGGGCGGGAGG - Intronic
946089391 2:217207493-217207515 TATTAGGGAGCAAGGCCTGGTGG + Intergenic
946372980 2:219291655-219291677 GAGAAAGGAGCCAGGGCTGGAGG + Intronic
947390161 2:229630782-229630804 GAGTGGGGAGGCAGGAAGGGGGG - Intronic
947564444 2:231185230-231185252 GAGAAGGGTGCCAGGCCTGCGGG - Intergenic
947635597 2:231679351-231679373 GGCTAGGGTGCCAGGCCGGATGG - Intergenic
947742497 2:232491021-232491043 GTGGAGGAAGCCAGGCCAGGAGG - Intergenic
948902215 2:240962551-240962573 GCCTCGGGAGCCAGGCCGGTCGG + Intronic
948902858 2:240965034-240965056 CAGGAGGGAGCCAGGCCTTGGGG - Intronic
948939037 2:241187183-241187205 GAGTCGGGAGGCAGGAGGGGAGG - Intergenic
1169195965 20:3682133-3682155 GAGGCGGGAGCGAGGGCGGGCGG - Exonic
1169422995 20:5474614-5474636 GAGGATGGAGCCAGGCCTGTCGG - Intergenic
1169426432 20:5500861-5500883 GAGGATGGAGCCAGGCCTGTCGG + Intergenic
1170678816 20:18507055-18507077 GAGTGGGGAGGGAGGCAGGGAGG + Intergenic
1170765865 20:19289727-19289749 GAGTGGGGAGCCAGGTGGGTGGG - Intronic
1171283683 20:23921316-23921338 GAGGAGGGGGTCAGGTCGGGAGG - Intergenic
1172377523 20:34456867-34456889 TAGTAAGGTGCCAGGCGGGGTGG - Intronic
1172700051 20:36847563-36847585 GAGTATGGGGCCAGGCGCGGTGG + Intronic
1174032501 20:47641470-47641492 AAGAAGGGAGCCAGGCGTGGTGG - Intronic
1174062347 20:47841722-47841744 GAGAAGGGAGCCAGGTGTGGTGG - Intergenic
1174073327 20:47914091-47914113 GAGACGGGAGCCAGGCATGGTGG + Intergenic
1174159889 20:48543221-48543243 GAGCAGGTGGCCAGGCCAGGTGG + Intergenic
1175205861 20:57310650-57310672 AGGGAGGCAGCCAGGCCGGGTGG - Intergenic
1175466711 20:59194399-59194421 GAGGAAGGAGCCAGGCTGGAGGG - Exonic
1175797089 20:61778580-61778602 AAGCAGGGAGCCACGCCTGGTGG + Intronic
1175914947 20:62421989-62422011 GAGCAGGAGGCCAGGCAGGGAGG - Intronic
1176056730 20:63152853-63152875 GAGAGGAGAGCCAGGCCCGGGGG + Intergenic
1176094229 20:63332612-63332634 GAGGAGGCAGCCTGGCCGGGGGG + Intronic
1176162159 20:63653448-63653470 GTGGAGGGAGCGAGGGCGGGCGG + Intergenic
1178075444 21:29011149-29011171 GACTAGGCAGCCAGGCAGAGGGG - Intronic
1178992612 21:37367654-37367676 GAGCCGAGCGCCAGGCCGGGCGG - Intronic
1179186091 21:39086290-39086312 GAGAAGGGGGCCAGGCATGGTGG + Intergenic
1179321061 21:40291580-40291602 GGGTAGGGGGCGAGGCCGGGAGG - Intronic
1179801786 21:43814657-43814679 AGGGAGGGAGCCAGGCCAGGAGG + Intergenic
1179901890 21:44398530-44398552 GGGTAGGGGGCCAGGCAGCGGGG + Intronic
1180786535 22:18550768-18550790 GAGCAGGAGGCCAGGCCAGGGGG + Intergenic
1181243455 22:21490321-21490343 GAGCAGGAGGCCAGGCCAGGGGG + Intergenic
1181307579 22:21925680-21925702 GAGTTGGGGGCAGGGCCGGGGGG + Intronic
1181309802 22:21938418-21938440 GGGCAGGGAGCCAGGGCGGAGGG + Intronic
1181457973 22:23070393-23070415 GCGGAGGGAACCAGGCCGGCCGG + Exonic
1181872087 22:25907745-25907767 GAGAAGGGGGCCGGGCCCGGTGG + Intronic
1183198165 22:36367625-36367647 GAGCAGGCAGCCTGGCCGGCAGG + Intronic
1183404974 22:37625952-37625974 GAGGAAGGGGCCAGGCCTGGAGG + Intronic
1183687464 22:39369469-39369491 CAGCAGGGAGGAAGGCCGGGAGG - Intronic
1183763132 22:39843638-39843660 GAGGAGGGAGGCAGGCAGGAAGG + Intronic
1183953765 22:41367407-41367429 GGCTAGGGAGGCAGGCGGGGTGG - Intronic
1184368921 22:44070257-44070279 GACTAGGGAGCCAGGCTGTTGGG - Intronic
1184450188 22:44578038-44578060 GAGTGGGGAGCCAGGCGCAGCGG - Intergenic
1184640416 22:45867345-45867367 GAGGTGGTGGCCAGGCCGGGCGG - Intergenic
1185318033 22:50187139-50187161 GAGGAGGGGGCCTGGCAGGGTGG + Intronic
1185366890 22:50440958-50440980 GAGCAGGGGTCCCGGCCGGGAGG + Exonic
950371736 3:12536711-12536733 GAGGAGGGGGCCAGGCGCGGTGG + Intronic
950665675 3:14493482-14493504 GACTGGGGTGCCAGGCAGGGAGG - Exonic
952032313 3:29158506-29158528 GTGGAGGGAGCCAGGCATGGTGG - Intergenic
952941497 3:38448233-38448255 GAGTAGGGAGCTGGGGTGGGTGG + Intergenic
953032088 3:39185863-39185885 GAGTACTGGGCCAGGGCGGGAGG - Exonic
953381511 3:42476189-42476211 AGGTAGGGAGCCAGGCTGTGGGG + Intergenic
953888549 3:46733974-46733996 GAGCAGGGGGCCTGGCTGGGTGG - Intronic
953915926 3:46921283-46921305 GAGTAGGGAGAGAGGCCGCCTGG + Intergenic
954382542 3:50227355-50227377 GAGGCGGGGGCCAGGCCCGGAGG + Intronic
954626001 3:52022235-52022257 GAGTTGGGAGCCAGGGTGGGGGG - Intergenic
955375038 3:58387610-58387632 TAGAAGGTAGCCAGGCCGAGAGG + Intronic
957598742 3:82304562-82304584 GAGTAGTGAGTCAGGCATGGTGG + Intergenic
958957529 3:100478338-100478360 GACTGGGCAGCCAGGCCGAGGGG + Intergenic
958957566 3:100478494-100478516 GACTGGGCAGCCAGGCCGAGGGG + Intergenic
959501160 3:107107175-107107197 GAGGAGCTAGCCGGGCCGGGGGG - Intergenic
960385649 3:117018877-117018899 GTGTAAGGAGTCAGACCGGGTGG - Intronic
960447259 3:117763650-117763672 GAGAAGGGAGGCAGGAAGGGAGG + Intergenic
961333830 3:126158455-126158477 GATGATGGAGCCATGCCGGGGGG + Exonic
963774895 3:149428733-149428755 GTGTTGGGAGACAGACCGGGTGG - Intergenic
966123637 3:176550093-176550115 GAGCAGGGAGCAAGGAAGGGTGG - Intergenic
966769949 3:183494643-183494665 GAGCAGGAAGCAAGGCTGGGCGG + Intronic
966948053 3:184791317-184791339 GAGTAGGGAGCGAGGCCAGTAGG + Intergenic
968443276 4:635280-635302 GGGCAGGGAGGCAGGCAGGGAGG - Intronic
968579191 4:1381951-1381973 CAGAAGGGACCGAGGCCGGGCGG - Intronic
969682847 4:8652766-8652788 CAGAAGGGAGCCAGGCCAAGGGG - Intergenic
970441153 4:16082548-16082570 CAGAAGGGAGCTAGGCCTGGAGG - Intronic
971705374 4:30035084-30035106 GAGTAGGGAGCCAGGCACAGTGG + Intergenic
974644236 4:64671772-64671794 TAGTAGGGAGGCTGGCAGGGGGG - Intergenic
975289708 4:72663421-72663443 AAGTAGGGAGGGAGGCAGGGAGG - Intergenic
976579212 4:86715437-86715459 TAGTTGGGAGCCAGGCGTGGTGG + Intronic
976736679 4:88317301-88317323 GAGTTGGGGGCCAGGCACGGTGG + Intergenic
979153613 4:117353814-117353836 AAGTAGAGAGCCAGGCAAGGTGG + Intergenic
979577799 4:122315929-122315951 GAGTAGGGAGTGGGGCAGGGTGG + Intronic
981081803 4:140644316-140644338 GAGTGGGGAGGCAGGCTGGTGGG + Intronic
981531056 4:145754029-145754051 GAGTAGGGGGCCAGGAGTGGAGG + Intronic
982721157 4:158861643-158861665 CAGTTGGGACCCAGGCCAGGTGG - Exonic
985315584 4:188655948-188655970 GAGAAGGGAGCCAGGCACAGTGG - Intergenic
985669901 5:1201847-1201869 GAGGAGGTAGGCTGGCCGGGCGG + Exonic
985767180 5:1786226-1786248 GGGCAGGGAGCCAAGCTGGGGGG - Intergenic
986340463 5:6784703-6784725 AAGGAGGGAGCCAGGCTGAGAGG + Intergenic
987373939 5:17217524-17217546 GAGGAGGGAGGCTGGGCGGGCGG + Intronic
988100150 5:26665386-26665408 GAATAGAGAGCCAGGCATGGTGG - Intergenic
988727853 5:33941849-33941871 GAGAAGGGAGCAAGGCTTGGAGG + Intergenic
990493120 5:56321279-56321301 GGGTAGAGGGCCAGGCTGGGTGG - Intergenic
990822478 5:59858026-59858048 GAGTAGGGAGGCATGCAGGCAGG + Intronic
990871100 5:60431587-60431609 GAGTGGGCAGCCAGGCAGAGGGG + Intronic
995512322 5:112921781-112921803 GAATAGGGCGCCGGGCCGCGGGG + Intronic
995741044 5:115356031-115356053 GGGTAAGGAGCCAGGCCTGTAGG + Intergenic
997851116 5:137333386-137333408 GAGGAGGGAGCCAAGTCAGGAGG + Intronic
998095324 5:139393043-139393065 GTGTAGTGAGCCGGGGCGGGGGG + Exonic
999188461 5:149730235-149730257 GAGGAGGGAGTGAGGCCGGCGGG - Intergenic
999268591 5:150283132-150283154 GAAGAGGGGGCCAGGCAGGGTGG - Intronic
1000089500 5:157917986-157918008 GGGTAGGGAGCCAGGGAGTGGGG + Intergenic
1000233651 5:159337796-159337818 GAGTAGGGAGCCAGGGAGTAAGG - Intergenic
1001073096 5:168603994-168604016 GAGGAGGCAGCCAGGATGGGAGG + Intergenic
1002128975 5:177067815-177067837 GAGAAGGAGGCCAGGCAGGGTGG + Intronic
1002258915 5:177981039-177981061 GAGTAGGGAGCCAGCCGTGCCGG + Intergenic
1002321031 5:178376064-178376086 GAGTAGGGAGGCAGGGCCAGGGG - Intronic
1002692590 5:181060457-181060479 GGGTAGGGAGCCAGGCCGAAGGG + Exonic
1003084792 6:3052816-3052838 GAGAAGGGGGCCAAGCCGTGGGG - Intergenic
1003088019 6:3076990-3077012 GAGTAGGGAGCAGGGGTGGGTGG + Intronic
1003459928 6:6320185-6320207 GAGTGGGGAGCCAAGCCGGCGGG + Intronic
1004415065 6:15416202-15416224 GACTGGGTAGCCAGGCCGAGGGG + Intronic
1006453240 6:34117475-34117497 GGGCAGGGAGCCAGGCTGGCAGG - Intronic
1006911890 6:37568755-37568777 GAAGAGGGAGCCAGGCCCAGAGG + Intergenic
1007414650 6:41684475-41684497 GAGGAGGGAGGCAGGGCAGGTGG + Exonic
1007626198 6:43247578-43247600 GAGTGGGGAGCCAGGGGGAGGGG + Intronic
1008956489 6:57221840-57221862 GATGGGGGAGCCGGGCCGGGAGG + Exonic
1011552723 6:88544713-88544735 GAGTAAGGAGCTAGGCAGGCAGG - Intergenic
1012960201 6:105614389-105614411 GAGTTGTGAGCCAGACAGGGTGG - Intergenic
1013155723 6:107490024-107490046 GGGGAGGGAGCGCGGCCGGGAGG - Exonic
1013225556 6:108117752-108117774 GAGGCGGGAGCCCGGCCGCGCGG + Intronic
1015339547 6:132082299-132082321 GAGAAGGCAGCCAGGCGCGGTGG - Intergenic
1018398176 6:163397088-163397110 CAGAAGGAAGCCAGGCCGCGAGG - Intergenic
1019176333 6:170161114-170161136 GGGGAGGGAGCGAGGCCAGGAGG - Intergenic
1019316021 7:387272-387294 GGGTCGGCAGCCAGGCCCGGGGG + Intergenic
1020035441 7:4960454-4960476 CAGTAGGGAGCCAGGCAGTGGGG - Intergenic
1020065120 7:5182514-5182536 GAGTGGGGAGCCAGGCACGGTGG - Intergenic
1020139691 7:5605651-5605673 GAGTAGGGAACCCGGGCGGAGGG - Exonic
1020897991 7:13966387-13966409 CAGTAGGGGGCCAAGGCGGGAGG + Intronic
1021025433 7:15660732-15660754 GAGAAAGGAGCCAGGCGTGGTGG + Intronic
1022413783 7:30160790-30160812 AAGTACGGAGCCAGGGAGGGAGG + Exonic
1022480176 7:30738398-30738420 GAGGAGGGAGCCAGGAATGGAGG + Intronic
1023584560 7:41715639-41715661 GAGTGGAGAGCAAGGCGGGGAGG - Intergenic
1023939404 7:44760227-44760249 GGGTAGGGGGCCTGGCCGGGAGG + Exonic
1024282954 7:47734647-47734669 GGGCAGGGAGCAAGGTCGGGTGG - Intronic
1025482027 7:60993317-60993339 GAGTTGGGAGTCAGACCTGGAGG + Intergenic
1026290441 7:69001214-69001236 GGGCAGGGAGCCAGGCAGTGGGG + Intergenic
1027048826 7:75008795-75008817 GAGTAAAGAGCCAGGCATGGTGG + Intronic
1027267607 7:76502885-76502907 GAGGTGGGAGCCAGGCCTTGAGG + Intronic
1027319417 7:77002750-77002772 GAGGTGGGAGCCAGGCCTTGAGG + Intergenic
1027597025 7:80186316-80186338 GAGTGGGGGGCCAGGCACGGTGG - Intronic
1027982974 7:85250269-85250291 AAGGCGGCAGCCAGGCCGGGGGG + Intergenic
1029384192 7:100232874-100232896 GAGTAAAGAGCCAGGCATGGTGG - Intronic
1029485255 7:100836315-100836337 GAGCAGGAAGCCAGGCCGGGTGG + Intronic
1029490484 7:100867675-100867697 GAGGAAGCAGCCAGGGCGGGAGG - Intronic
1029681819 7:102116808-102116830 CAGTGGTGAGCCAGGCCGAGGGG + Intronic
1033147109 7:138880813-138880835 GAATGGGGAGCGAGGCAGGGAGG + Intronic
1034377557 7:150659407-150659429 GAGGAGGGAGCCTGGCCCTGAGG - Intergenic
1034970004 7:155412970-155412992 GTGTTGGGAGCCAGGCTGGGAGG + Intergenic
1036521045 8:9491961-9491983 AATTAGGGTGCCAGGCCCGGTGG + Intergenic
1036705003 8:11040116-11040138 CAGTAAGGACCCAGGCCGGGGGG + Intronic
1036725737 8:11219067-11219089 GGGTAGGGGGCCAGGCATGGTGG - Intergenic
1037567597 8:20130635-20130657 GAGGAGGCAGCAAGGCTGGGAGG - Intergenic
1037744360 8:21631035-21631057 GTGTAGTGAGCCAGGTCTGGAGG - Intergenic
1039447495 8:37644367-37644389 GAGTTGGGAGCCAGGTGGAGGGG + Intergenic
1041362999 8:57071795-57071817 GACTAGGCAGCCAGGCAGAGGGG + Intergenic
1041513657 8:58676763-58676785 GACTAGGCAGCCAGGCAGAGGGG + Intergenic
1041719080 8:60960253-60960275 GGGTAGGCAGGCAGGCAGGGAGG - Intergenic
1042772727 8:72396904-72396926 GATTAGGGTGCCAGGCAGAGGGG - Intergenic
1043303369 8:78762507-78762529 GGGAGGGGAGCCAGGCCGGCCGG + Intronic
1044570454 8:93712217-93712239 GGGTTGGGAGGCAGGCAGGGGGG - Intronic
1044872035 8:96628893-96628915 GAGGAGGGAGGAAGGCAGGGAGG - Intergenic
1045308565 8:100980706-100980728 GTTTAGGGTGCCAGGGCGGGTGG + Intergenic
1047998477 8:130358256-130358278 GAGCCGCGCGCCAGGCCGGGCGG - Intronic
1049553265 8:143270388-143270410 GAGCAGGGAGCCAGGCAGCTTGG + Intronic
1049675278 8:143886391-143886413 GGGTGGGTAGGCAGGCCGGGCGG + Intergenic
1049708640 8:144053976-144053998 GAGTGGAGAGCGAGGGCGGGGGG - Intronic
1049794054 8:144488470-144488492 TAGTAGCGAGCCAGGCAGAGAGG + Intronic
1050298755 9:4235009-4235031 GATGAGGGAGCCAGGCGCGGTGG + Intronic
1050552377 9:6758875-6758897 GAGGAGGGAGCCAGACAGGCCGG + Intronic
1050791213 9:9472488-9472510 GAGTAGGGGGCCGGGCGTGGTGG - Intronic
1052855143 9:33402348-33402370 GAGTGGGGCTCCAGGCAGGGTGG - Intronic
1053288429 9:36864655-36864677 GAGGAGGCAGGCAGGCCGGTGGG - Intronic
1053683162 9:40498689-40498711 GAGTGGGGCTCCAGGCAGGGTGG - Intergenic
1053788038 9:41666200-41666222 GAGGAGGGAGGCAGGAAGGGAGG + Intergenic
1053933139 9:43127005-43127027 GAGTGGGGCTCCAGGCAGGGTGG - Intergenic
1054157095 9:61648568-61648590 GAGGAGGGAGGCAGGAAGGGAGG - Intergenic
1054176314 9:61877542-61877564 GAGGAGGGAGGCAGGAAGGGAGG + Intergenic
1054280552 9:63126239-63126261 GAGTGGGGCTCCAGGCAGGGTGG + Intergenic
1054296263 9:63334187-63334209 GAGTGGGGCTCCAGGCAGGGTGG - Intergenic
1054394279 9:64638692-64638714 GAGTGGGGCTCCAGGCAGGGTGG - Intergenic
1054428929 9:65143891-65143913 GAGTGGGGCTCCAGGCAGGGTGG - Intergenic
1054476870 9:65579573-65579595 GAGGAGGGAGGCAGGAAGGGAGG - Intergenic
1054501451 9:65877644-65877666 GAGTGGGGCTCCAGGCAGGGTGG + Intronic
1054661225 9:67703266-67703288 GAGGAGGGAGGCAGGAAGGGAGG - Intergenic
1056002432 9:82231139-82231161 GAGTGAGGAGCAAGGCCAGGTGG - Intergenic
1056195599 9:84225508-84225530 GAGTATGGAGCCAGGCGCGGTGG + Intergenic
1057389062 9:94627920-94627942 GGGAAGGGAGCTAGGCCTGGAGG - Intronic
1058049315 9:100390999-100391021 GAGTAGGAGGCCAGGCGTGGTGG + Intergenic
1058860067 9:109107493-109107515 GAGGAGGGAGGCAGGCAGGCAGG - Intronic
1059431539 9:114253429-114253451 GAGGAGGGAGGGAGGGCGGGAGG + Intronic
1060812164 9:126615920-126615942 TTTTAGGGAGCCAGGCCTGGCGG + Intronic
1061973085 9:134055177-134055199 GAGCAGGGAGCCCTGCTGGGAGG - Intronic
1062148116 9:135001943-135001965 GAGGAGGGAGCAAGACCCGGAGG + Intergenic
1062397604 9:136358715-136358737 GAGTGGGGAGACAGGCTTGGAGG - Exonic
1062595175 9:137296063-137296085 GGGGAGGGAGCCGGGCCGTGGGG - Intergenic
1062597479 9:137305789-137305811 CAGGATGCAGCCAGGCCGGGTGG + Intergenic
1062630092 9:137459476-137459498 GAGTTGGGGGCGGGGCCGGGCGG + Intergenic
1186470708 X:9820086-9820108 GTGGAGGGAGCCAGGCACGGTGG - Intronic
1189056934 X:37707720-37707742 GAGTGGGCAGCCAGGCAGAGGGG + Intronic
1189323115 X:40097987-40098009 GAGGAGGGAACCAGGGAGGGGGG - Intronic
1189338787 X:40188190-40188212 GAGTAGGCGGCCAGGCTCGGTGG - Intergenic
1189388417 X:40556237-40556259 GAAAAGGGAGCCAGGCACGGTGG - Intergenic
1189955728 X:46275190-46275212 GACTAGGCAGCCAGGCAGAGGGG - Intergenic
1190213821 X:48467432-48467454 GAGGAGAAAGGCAGGCCGGGAGG + Intronic
1192449596 X:71235688-71235710 AAGAAGGGAGACAGGCAGGGAGG - Intergenic
1195059186 X:101177464-101177486 GAGCATTGAGCCAGGCTGGGTGG + Intergenic
1197871756 X:131068349-131068371 GATGAGCGAGCCAGGCGGGGCGG + Intronic
1198459429 X:136848942-136848964 CAGTAGGGAGCCGGGCGTGGTGG - Intronic
1200077406 X:153558015-153558037 GAGCAGGGAGCCAGCCCAGGCGG + Intronic
1200092546 X:153642650-153642672 GCGGGGGCAGCCAGGCCGGGTGG - Intronic