ID: 1091263683

View in Genome Browser
Species Human (GRCh38)
Location 11:134253838-134253860
Sequence CGGAGTAGGGAGCCAGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091263683_1091263698 10 Left 1091263683 11:134253838-134253860 CCCCGGCCTGGCTCCCTACTCCG 0: 1
1: 0
2: 0
3: 19
4: 232
Right 1091263698 11:134253871-134253893 CCCGGCCTGGCTGCCCCCTCCGG 0: 1
1: 0
2: 6
3: 149
4: 2064
1091263683_1091263693 -3 Left 1091263683 11:134253838-134253860 CCCCGGCCTGGCTCCCTACTCCG 0: 1
1: 0
2: 0
3: 19
4: 232
Right 1091263693 11:134253858-134253880 CCGGCCGGTCACCCCCGGCCTGG 0: 1
1: 2
2: 3
3: 9
4: 176
1091263683_1091263700 14 Left 1091263683 11:134253838-134253860 CCCCGGCCTGGCTCCCTACTCCG 0: 1
1: 0
2: 0
3: 19
4: 232
Right 1091263700 11:134253875-134253897 GCCTGGCTGCCCCCTCCGGTCGG 0: 1
1: 0
2: 1
3: 53
4: 393
1091263683_1091263708 29 Left 1091263683 11:134253838-134253860 CCCCGGCCTGGCTCCCTACTCCG 0: 1
1: 0
2: 0
3: 19
4: 232
Right 1091263708 11:134253890-134253912 CCGGTCGGTCACCACCATCCGGG 0: 1
1: 0
2: 0
3: 1
4: 53
1091263683_1091263691 -8 Left 1091263683 11:134253838-134253860 CCCCGGCCTGGCTCCCTACTCCG 0: 1
1: 0
2: 0
3: 19
4: 232
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263683_1091263706 28 Left 1091263683 11:134253838-134253860 CCCCGGCCTGGCTCCCTACTCCG 0: 1
1: 0
2: 0
3: 19
4: 232
Right 1091263706 11:134253889-134253911 TCCGGTCGGTCACCACCATCCGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091263683 Original CRISPR CGGAGTAGGGAGCCAGGCCG GGG (reversed) Intronic
900224603 1:1527089-1527111 GGGACTAGGGAGCCTGGCCATGG - Intronic
900309061 1:2024707-2024729 CGGAGGAGGAAGCCAGGTCAGGG + Intronic
901428256 1:9197329-9197351 AGCAGAAGGGAGGCAGGCCGGGG - Intergenic
901844038 1:11971061-11971083 AGGAGTAGGGAGCCTGGGAGGGG + Intronic
903130898 1:21279062-21279084 CTAAGGAGGGAGCCAGGCCCAGG - Intronic
903573344 1:24322205-24322227 GAGAGCAGGGAGCGAGGCCGCGG - Intronic
903633847 1:24799128-24799150 CAGACTAGGCAGCCAGGCAGAGG - Intronic
905351820 1:37352304-37352326 CGGAGGTGGGAGCCATGCAGAGG - Intergenic
906741883 1:48192224-48192246 CAGACTAGGCAGCCAGGCAGAGG - Intergenic
907089709 1:51711925-51711947 CAGACTAGGCAGCCAGGCAGAGG + Intronic
907394004 1:54177123-54177145 AGCAGTAGGGAGCCAGGCAAGGG + Intronic
907402378 1:54233063-54233085 CAGAGTGGGCAGCCAGGCAGAGG - Intronic
907453876 1:54562919-54562941 CAGAGTGGGCAGCCAGGCAGAGG + Intronic
912316909 1:108675553-108675575 CAGACTAGGCAGCCAGGCAGAGG - Intergenic
912476775 1:109942994-109943016 TGGAGAAGGGAGTGAGGCCGAGG + Intergenic
915027382 1:152843592-152843614 TCGAGTAGGGAGCTAGGCAGGGG - Exonic
915208318 1:154287403-154287425 CAGACTAGGCAGCCAGGCAGAGG - Intergenic
915562367 1:156694685-156694707 GGGAGTAGGGAGCCAGGCTAAGG + Intergenic
915668861 1:157470381-157470403 TGGAGAAGGGAGGCAGGCTGTGG - Intergenic
915719721 1:157975887-157975909 AGGAGCTGGGAGCCAGGCCAGGG - Intergenic
920065927 1:203269694-203269716 GGAAGGAGGGAGCCAGGCTGTGG + Intronic
920520513 1:206621361-206621383 CTGACTAGGGAGCCATGCTGAGG + Intergenic
920692865 1:208159970-208159992 TGGGGGAGGGAGCCAGGCCATGG + Intronic
922469990 1:225870452-225870474 TGGTGTAGGGAGCCAGGAGGCGG - Intronic
924482851 1:244452110-244452132 GGGAGTGGCGCGCCAGGCCGCGG - Exonic
1062832353 10:614308-614330 CGGAGACGGGAGCCTGGCCAAGG + Intronic
1064012176 10:11743448-11743470 AGGGGTAGAGAGCCAGCCCGTGG + Intronic
1067596909 10:47565594-47565616 CGGGGTAGCGCGCCGGGCCGTGG - Intergenic
1070747275 10:78941733-78941755 TGGAGTAGGGGGCCTGGCTGAGG - Intergenic
1072620533 10:97076258-97076280 CTGAGCAGGGAGCCAGGGCTGGG - Intronic
1073196349 10:101694890-101694912 CGAAGGAGGCAGCCGGGCCGGGG - Exonic
1075992114 10:126846802-126846824 AGGAGTGGGGAGTCAGGACGGGG - Intergenic
1076140964 10:128078254-128078276 CTGACTTGGGAGCCAGGCTGAGG - Intronic
1077026694 11:442789-442811 GGGAGTGGGGGCCCAGGCCGTGG + Intergenic
1077221866 11:1421459-1421481 AGGAGGCGGGAGCCAGGCAGAGG + Intronic
1077307239 11:1873883-1873905 CAGAGCAGGGAGCCCGGCAGAGG + Intronic
1077307253 11:1873917-1873939 CGGAGGAGGGAGGCCGGCAGAGG + Intronic
1077307264 11:1873951-1873973 CAGAGCAGGGAGCCCGGCGGAGG + Intronic
1077307272 11:1873968-1873990 CGGAGGAGGGAGGCCGGCGGAGG + Intronic
1077504007 11:2921930-2921952 CGGAGTAGGGAGAGACCCCGGGG + Intronic
1078143425 11:8707595-8707617 CTGGGTAGAGAACCAGGCCGGGG + Intronic
1079018266 11:16887877-16887899 CAGACTAGGCAGCCAGGCAGAGG - Intronic
1083441031 11:62676752-62676774 GGGAGTAGGGAGGCATGCCTAGG - Exonic
1083741637 11:64714341-64714363 TGGAGGTGGGAGCCAGGCAGAGG - Intronic
1083831972 11:65239101-65239123 CAGACTAGGCAGCCAGGCAGAGG - Intergenic
1084068257 11:66718026-66718048 CGGAGGGGTGAGCCAGGCCCAGG - Intronic
1084924886 11:72503053-72503075 CAGACTAGGCAGCCAGGCAGAGG + Intergenic
1085176388 11:74492314-74492336 AGCAGTTGAGAGCCAGGCCGTGG + Exonic
1087926948 11:103929811-103929833 CAGAGCAGGGAGCCAGACAGAGG + Intronic
1089776017 11:120836561-120836583 AGGGGTAGGGGGCCAGGCGGAGG + Intronic
1090423680 11:126592678-126592700 GGGAGGAGGGAGCCAGGGTGGGG + Intronic
1091263683 11:134253838-134253860 CGGAGTAGGGAGCCAGGCCGGGG - Intronic
1091263696 11:134253870-134253892 CGGAGGGGGCAGCCAGGCCGGGG - Intronic
1091269054 11:134292893-134292915 CAGAGAAGTGAGCCAGGCCAAGG - Intronic
1091596546 12:1882597-1882619 CGGAGCAGGGACCCTGTCCGTGG + Intronic
1096143788 12:49264565-49264587 CGGCGTAGGGAGCGCAGCCGCGG + Intronic
1096482433 12:51951639-51951661 GGGAGGCGGGAGCCGGGCCGCGG + Intergenic
1096677231 12:53232315-53232337 CAGAGGAGGGAGCCGGGCAGGGG - Intronic
1096798540 12:54093963-54093985 TGGAGTTGGGAGCCAGGCAGAGG + Intergenic
1097779489 12:63686641-63686663 CAGAGTGGGCAGCCAGGCAGAGG - Intergenic
1102375583 12:112418913-112418935 AGGAGGAGCGAGCCGGGCCGGGG + Exonic
1102810668 12:115821386-115821408 TGGAGAAGGGTGCCAGGCAGTGG + Intergenic
1103239168 12:119398524-119398546 CAGAGTAGGCACCAAGGCCGAGG + Intronic
1104084898 12:125465572-125465594 GGGAGTAGGAAGCCAGGTCCAGG - Intronic
1104854502 12:131895459-131895481 CCGAGTGGGGAGCCAGGTTGAGG - Intronic
1108542473 13:51456675-51456697 CACAGGAGGGAGGCAGGCCGAGG - Intergenic
1108662639 13:52600428-52600450 CGGAAGTGGGCGCCAGGCCGCGG + Intergenic
1110950320 13:81480145-81480167 CGGAGTTGGGAGCTAGGGTGAGG - Intergenic
1112056247 13:95691567-95691589 CAGACTAGGCAGCCAGGCAGAGG + Intronic
1112717024 13:102198580-102198602 CTGAGTAAGGAGACAGGGCGTGG + Intronic
1113536124 13:111067478-111067500 CGCAGCACGGAGCCTGGCCGCGG + Intergenic
1121443994 14:93967215-93967237 AGGAGTGGGAAGCCAGGCCTGGG - Intronic
1121674411 14:95740899-95740921 GGGAGTAGAGAGCCTGGCCCAGG + Intergenic
1122016680 14:98802482-98802504 CAGAGTAAGGAGCCTGGCTGAGG - Intergenic
1124132761 15:27004460-27004482 CGGACTGGGCAGCCAGGCAGAGG + Intronic
1127211507 15:56779501-56779523 CAGAGTGGGCACCCAGGCCGAGG - Intronic
1127251717 15:57245579-57245601 CTGAGTAGGAAGGCAGGCCATGG + Intronic
1127620017 15:60724880-60724902 GGGAGGAGGGAGCCAGGACCTGG - Intronic
1128147162 15:65338054-65338076 AGGAGGAGGGAGTCAGGCAGTGG - Intronic
1128743369 15:70097724-70097746 CGGAGAGGAGAGCCGGGCCGAGG - Exonic
1129154802 15:73711062-73711084 TGGGGTAGGGAGTCAGGCAGAGG - Intronic
1130933196 15:88447335-88447357 GGCAGTATGGAGCCAGGCAGGGG - Intergenic
1131121769 15:89827514-89827536 GGAAGGAGGGAGCCAGGCAGGGG + Intergenic
1132128434 15:99251447-99251469 CGGGGCAGGGAGCCAGGCGAGGG - Exonic
1132702052 16:1226172-1226194 GGGAGGAGGGTGCCCGGCCGTGG - Intergenic
1132783343 16:1640896-1640918 CTGAGGAGGGGGCCAGGCAGGGG + Intronic
1133026345 16:2990503-2990525 AGGAGGAGGGAGGCAGGCAGGGG - Intergenic
1133047756 16:3098672-3098694 CTGGGTAGGGAGGCAGGCAGAGG + Intronic
1133752163 16:8733344-8733366 CAGACTGGGCAGCCAGGCCGAGG + Intronic
1134446197 16:14333237-14333259 CAGAATAGGATGCCAGGCCGTGG - Intergenic
1137686530 16:50390636-50390658 CGGAGCTGGGACCCAGGCAGGGG + Intergenic
1138461952 16:57154397-57154419 CAGAGTAGGCACCCAGGCCTGGG + Exonic
1139517165 16:67458924-67458946 GGGAGTAGGGAGCCAAGATGTGG - Intronic
1140583952 16:76265558-76265580 AGGAGTAGGGAGCCTGGTTGGGG + Intergenic
1141421044 16:83915753-83915775 CCGGGCAGGGAGCCAGGCCAAGG - Exonic
1141436584 16:84003044-84003066 CGGAGTGGGGGGCCAGGCACGGG + Intergenic
1141703178 16:85651606-85651628 CGGAGGAGGGCGGCAGGCCTGGG + Intronic
1142012919 16:87726254-87726276 CGGCGTGGGGAGACGGGCCGAGG - Intronic
1142134911 16:88447387-88447409 GGGAGGAGGGAGCCAGCACGTGG - Intergenic
1142529794 17:572026-572048 CGGACTGGGCAGCCAGGCAGAGG - Intronic
1142639747 17:1279154-1279176 TGGAGTCGGGAGCCAGGCTTTGG + Intergenic
1143021100 17:3917581-3917603 CTGGGCAGGGAGCCAGGCCCTGG + Intergenic
1144205754 17:12978535-12978557 GGGAGCAGGGAGCTGGGCCGGGG - Intronic
1144782437 17:17814799-17814821 CTGAGAAGGGAGCCAGGACAGGG + Intronic
1145782741 17:27574005-27574027 CTGGGGAGGGAGCCAGGCTGAGG - Intronic
1146147010 17:30427911-30427933 CAGAGTAGGGGGACAGGCGGGGG - Intronic
1147267583 17:39244255-39244277 AGGAGGAGGGGGCCAGGCAGAGG - Intergenic
1150549662 17:66197656-66197678 GGTAGCAGGGAGCCAGGCCTGGG + Intergenic
1152309132 17:79538503-79538525 CAGAGCAGGGAACCAGGCCTTGG - Intergenic
1152754256 17:82080549-82080571 TGTAGTAGGCAGCCAGGCTGTGG + Exonic
1157402276 18:47398582-47398604 GGGAGTGGTGAGCCAGGCCAAGG - Intergenic
1160419179 18:78732444-78732466 GAGCGTAGGAAGCCAGGCCGAGG - Intergenic
1160786119 19:900846-900868 CGGAGGAGGGGCCCTGGCCGTGG - Exonic
1161193999 19:2976084-2976106 GGGAGTAAGGAGCCAGCCGGTGG + Intergenic
1162127172 19:8505964-8505986 CGGAGAAGGGAGCCCGGACCAGG + Intergenic
1163353907 19:16797277-16797299 AGGAGAAGGGATCCAGGACGGGG - Intronic
1163653443 19:18532060-18532082 CGGAGGAGGGGGCCAGACCAGGG + Exonic
1165359865 19:35329606-35329628 AGGAGTAGGGCCCCAGGCCCGGG - Intronic
1165742100 19:38210712-38210734 GGGAGGCGGGAGCCGGGCCGGGG - Intergenic
1165768370 19:38364434-38364456 CAGAGTGGGCAGCCAGGCAGAGG + Intronic
1165778252 19:38417580-38417602 AGGAGCTGGGAGCCAGGCAGAGG + Intronic
1166660554 19:44644203-44644225 CGGAGCTGGGAGCCAGACAGGGG - Intronic
1166978980 19:46621721-46621743 GGGAGGAGGGAGCCAGGGTGGGG - Intronic
1167590438 19:50401884-50401906 AGAAGTAGGGAGCGAAGCCGTGG - Exonic
1167717465 19:51153104-51153126 AGGAGTGGGCAGCCAGGCCATGG - Exonic
927809701 2:26174077-26174099 CGGGGCTGGCAGCCAGGCCGGGG + Intronic
929536348 2:42786752-42786774 GGGAGTGGGGAGCCGGGCCAGGG + Intronic
930605389 2:53487834-53487856 CGAAGTAGGTAACCAGGCCAGGG - Intergenic
930834031 2:55774254-55774276 CAGACTAGGCAGCCAGGCAGAGG + Intergenic
931253543 2:60552571-60552593 CGGAGTCGGGAGAGGGGCCGCGG - Intronic
932441936 2:71743092-71743114 CAGAGAAGGGAGCCGGGCCCAGG + Intergenic
935702988 2:105829008-105829030 TGGAGTAGAGTGCCAGGCCTAGG + Intronic
937161744 2:119769438-119769460 GGGAGTGGGGAGCCAGGAAGTGG + Intronic
938064314 2:128272876-128272898 CAGAGGAGAGAGCCAGGCCTGGG - Intronic
938070608 2:128306371-128306393 TGGAGCAGGGAGCCAGGCTGTGG - Intronic
942463901 2:176188741-176188763 CGGAGTACGGAGCCGGGCAGAGG - Exonic
944414627 2:199469439-199469461 AGGAGTAGTGAGCGATGCCGGGG - Intronic
948310482 2:236981985-236982007 TGGAGGAGGCAGCCAGGCTGGGG + Intergenic
1169427086 20:5504714-5504736 CCGAGAAGGAGGCCAGGCCGGGG + Intergenic
1171427621 20:25058337-25058359 CGGAGCAGGGTCCCAGGCCCTGG + Intronic
1171850368 20:30303784-30303806 TGGAGTTGGGAGCCAGGCAGAGG + Intergenic
1172845782 20:37929318-37929340 AGGAGCAGGGAGTCAGGCAGAGG + Intronic
1173401955 20:42733862-42733884 GGGAGTAGGGAGGAAGGCCTTGG + Intronic
1174286908 20:49480479-49480501 CAGAGGAGGAAGCCAGGCCCAGG + Intronic
1175089084 20:56486933-56486955 AGGAGCAGGGAGAGAGGCCGAGG + Intronic
1175479232 20:59300060-59300082 AGAGGTAGGGAGCCAGCCCGAGG + Intergenic
1175935541 20:62512198-62512220 CCGAGCATGGAGCCCGGCCGAGG + Intergenic
1176094227 20:63332610-63332632 AGGAGGAGGCAGCCTGGCCGGGG + Intronic
1176101391 20:63366070-63366092 GGGGGCAGGGAGCCAGGCCTGGG - Intronic
1178075446 21:29011151-29011173 CAGACTAGGCAGCCAGGCAGAGG - Intronic
1179421239 21:41238397-41238419 AGGAGGAGGGAGGCAGGCAGGGG + Intronic
1180569561 22:16702484-16702506 CTGAGCAGGGAGGCAGGCAGAGG - Intergenic
1182447206 22:30396931-30396953 CGGAGTAGGGAGCGATGCGCTGG - Exonic
1185277385 22:49955714-49955736 AAGAGCAGGGACCCAGGCCGAGG + Intergenic
949980752 3:9500513-9500535 CAGAGTGGGGAGACAGGCAGGGG + Exonic
951184898 3:19702443-19702465 CGGAGTGGGCACCGAGGCCGAGG - Intergenic
952234859 3:31468602-31468624 CAGAGAAGGGAGCCTGGCAGGGG + Intergenic
953905046 3:46864488-46864510 TGCAGTGGGGAGCCAGGCCTGGG - Intronic
953909117 3:46882998-46883020 CGGCGTAGGGAGTCAGGGCCGGG - Intronic
954574936 3:51670903-51670925 CGCAGTAGAGGGCCAGGCTGGGG - Intronic
954626003 3:52022237-52022259 GGGAGTTGGGAGCCAGGGTGGGG - Intergenic
957919727 3:86731915-86731937 CAGAGTAGGCACCAAGGCCGAGG + Intergenic
958957527 3:100478336-100478358 CAGACTGGGCAGCCAGGCCGAGG + Intergenic
958957564 3:100478492-100478514 CAGACTGGGCAGCCAGGCCGAGG + Intergenic
961222670 3:125212614-125212636 CGCAGTTAGGAGCCAGGCCTGGG - Intronic
966854356 3:184183991-184184013 CAGAGTAGGGACTGAGGCCGGGG - Exonic
967055336 3:185825093-185825115 CGGTGGGGGGAGCCAGGCTGAGG - Intergenic
968448125 4:662718-662740 TGGAGTACGGGGCCTGGCCGTGG - Intronic
968479520 4:827065-827087 CAGTGTCGGGAGCCAGGCGGCGG + Intergenic
968481279 4:834181-834203 CCCAGGAGGGAGCCAGTCCGTGG - Intergenic
968517298 4:1020702-1020724 CGGGGTGGGGACCCAGGCAGGGG + Intronic
968517313 4:1020731-1020753 CGGGGTGGGGACCCAGGCAGGGG + Intronic
968517361 4:1020824-1020846 CGGGGTGGGGACCCAGGCAGGGG + Intronic
968517376 4:1020853-1020875 CGGGGTGGGGACCCAGGCAGGGG + Intronic
968517422 4:1020945-1020967 CGGGGTGGGGACCCAGGCAGGGG + Intronic
968517437 4:1020974-1020996 CGGGGTGGGGACCCAGGCAGGGG + Intronic
968517452 4:1021003-1021025 CGGGGTGGGGACCCAGGCAGGGG + Intronic
968517467 4:1021032-1021054 CGGGGTGGGGACCCAGGCAGGGG + Intronic
969230445 4:5826775-5826797 AGAAGGAGGGAGCCAGGCCTGGG - Intronic
969682849 4:8652768-8652790 AGCAGAAGGGAGCCAGGCCAAGG - Intergenic
969721352 4:8894402-8894424 CGGAGGAGGGGGCCAGGAGGGGG - Intergenic
971037870 4:22714788-22714810 TGGAAGAGGGAGCAAGGCCGTGG + Intergenic
984923943 4:184790084-184790106 CAGAGTAGGGCGGCAGGCTGAGG + Intronic
985064219 4:186105241-186105263 GGGAGTCCGGAGCCAGGGCGCGG - Intronic
986695828 5:10353806-10353828 AGGAGGAGGGAGCCGGGCCCGGG - Exonic
989138810 5:38181935-38181957 ATGAGTAGGGAGCAAGGCAGGGG + Intergenic
990871098 5:60431585-60431607 CAGAGTGGGCAGCCAGGCAGAGG + Intronic
995512320 5:112921779-112921801 AGGAATAGGGCGCCGGGCCGCGG + Intronic
998401119 5:141849661-141849683 CGGCCTAGGGAGCTAGGGCGCGG + Intergenic
998401140 5:141849732-141849754 CGGAGGAGGGAGCAACGCCCCGG + Intergenic
1001453682 5:171845242-171845264 GGCAGTGGGGAGCCAGGCCAGGG - Intergenic
1001535972 5:172498097-172498119 CGGCGTGGTGGGCCAGGCCGAGG - Intergenic
1001651276 5:173317986-173318008 AGCAGTAGGGAGACTGGCCGAGG - Exonic
1001773107 5:174310416-174310438 TGGAGCAGAGAGCCAGGCTGAGG - Intergenic
1002455767 5:179344865-179344887 CCGAGGGGGGAGCCAGGGCGAGG - Intronic
1003084794 6:3052818-3052840 CTGAGAAGGGGGCCAAGCCGTGG - Intergenic
1003733918 6:8856448-8856470 AGCAGTAGTGAGCCAGGCTGCGG - Intergenic
1003946008 6:11076692-11076714 AGGAGTAGGGAGCCAGGGAGAGG - Intergenic
1004415063 6:15416200-15416222 CAGACTGGGTAGCCAGGCCGAGG + Intronic
1004441980 6:15662732-15662754 CGGGGAAGGGAGCGAGGCAGGGG + Intronic
1006682121 6:35805047-35805069 GCGACTAGGGAGCCAGGCAGGGG + Intergenic
1006814033 6:36839082-36839104 CAGAATAGGAAGCCAGGCTGGGG - Intronic
1007626196 6:43247576-43247598 CGGAGTGGGGAGCCAGGGGGAGG + Intronic
1019722687 7:2582732-2582754 GGGAGTAGGGACACAGGACGGGG - Intronic
1020035443 7:4960456-4960478 GGCAGTAGGGAGCCAGGCAGTGG - Intergenic
1024181284 7:46897623-46897645 TGGAGAAGGGAGCCAGGCCCGGG + Intergenic
1024537472 7:50450141-50450163 GGGAGGCGGGAGCCAGGCAGTGG - Intronic
1024940747 7:54760428-54760450 CAGTGTAGGGAGACAGACCGAGG - Intergenic
1029409103 7:100397587-100397609 CGGTGGAGGGAGCCAGGTTGGGG + Intronic
1029409268 7:100398383-100398405 TGGAGAGGGGAGCCAGGCAGAGG - Intronic
1029681816 7:102116806-102116828 CCCAGTGGTGAGCCAGGCCGAGG + Intronic
1032037695 7:128531821-128531843 CGGGGGAGGGCGCCAGGCCTGGG + Intergenic
1034241806 7:149616725-149616747 CGGAGCAGAGAAGCAGGCCGTGG + Intergenic
1034455642 7:151168238-151168260 CGGAGCTGGGAGGCACGCCGGGG - Intronic
1034680697 7:152925497-152925519 CGGGGGAGGGACCCAGGCCAGGG + Intergenic
1034830535 7:154304386-154304408 CGGTGCAGGGAGCCAGGCAGGGG + Intronic
1035300435 7:157893822-157893844 AGGAGGAGGGAGCCAGGCCCTGG + Intronic
1035348639 7:158226938-158226960 GGGAGGAGGGAGCCAGGCTGAGG + Intronic
1036620627 8:10422757-10422779 TGCAGTAGGGAGCTGGGCCGGGG + Intronic
1036705001 8:11040114-11040136 TGCAGTAAGGACCCAGGCCGGGG + Intronic
1037281380 8:17246535-17246557 CGGAGGAAGGAGCCTGGCGGCGG - Intronic
1037562425 8:20087020-20087042 CAGTCTAGGGAGCCAGGACGTGG + Intergenic
1039447493 8:37644365-37644387 AGGAGTTGGGAGCCAGGTGGAGG + Intergenic
1040470407 8:47731610-47731632 CAGAGTTGGGAGCCAGCCCAAGG + Intronic
1041097578 8:54364737-54364759 AGGAGGAGGGAGCCAGGACTTGG - Intergenic
1041362997 8:57071793-57071815 CAGACTAGGCAGCCAGGCAGAGG + Intergenic
1041513655 8:58676761-58676783 CAGACTAGGCAGCCAGGCAGAGG + Intergenic
1042772729 8:72396906-72396928 CTGATTAGGGTGCCAGGCAGAGG - Intergenic
1045423414 8:102039581-102039603 CAGAATAGGGAGCCAGTCCCAGG - Intronic
1045432724 8:102128396-102128418 CTGAGGAAGGAGCCAGGCAGGGG + Intergenic
1048327470 8:133450599-133450621 CGGGGTGGGGATCCAGGCAGGGG - Intergenic
1053272956 9:36762722-36762744 TGCAGGAGGGAGCCAGGCTGGGG + Intergenic
1053788149 9:41667075-41667097 TGGAGTTGGGAGCCAGGCAGAGG + Intergenic
1054156988 9:61647693-61647715 TGGAGTTGGGAGCCAGGCAGAGG - Intergenic
1054176426 9:61878414-61878436 TGGAGTTGGGAGCCAGGCAGAGG + Intergenic
1054476761 9:65578701-65578723 TGGAGTTGGGAGCCAGGCAGAGG - Intergenic
1054661112 9:67702394-67702416 TGGAGTTGGGAGCCAGGCAGAGG - Intergenic
1058674787 9:107391024-107391046 TGGAGGAGGGAGCCAGGCATTGG + Intergenic
1059854004 9:118375149-118375171 AGGAGTAGGGAGGGAGGCCAAGG - Intergenic
1060897055 9:127224983-127225005 TGGAGTTGGGAGCGGGGCCGGGG + Intronic
1061313406 9:129778544-129778566 CAGAGGAGGGAGGCAGGCCTTGG + Intergenic
1061348220 9:130043292-130043314 CGGGGGAGGGGGCCGGGCCGGGG - Intergenic
1061578470 9:131522499-131522521 GGGAGCAGGGAGCAAGGCCCAGG + Intronic
1062595177 9:137296065-137296087 GGGGGGAGGGAGCCGGGCCGTGG - Intergenic
1185566609 X:1099743-1099765 AGGTGAAGGGAGCCAGGCTGGGG + Intergenic
1189056932 X:37707718-37707740 CAGAGTGGGCAGCCAGGCAGAGG + Intronic
1189954719 X:46265512-46265534 GGGAGCAGGGAGCCAGGATGAGG + Intergenic
1190554405 X:51618723-51618745 CGGGGTCGGGAGCCACGCGGCGG - Intergenic
1190560706 X:51682681-51682703 CGGGGTCGGGAGCCACGCGGCGG - Intergenic
1190563585 X:51710640-51710662 CGGGGTCGGGAGCCACGCGGCGG + Intergenic
1190915377 X:54808224-54808246 GGGAGTAGGGAGCCAGGCTAAGG + Intronic
1197459530 X:126723583-126723605 GGGATTACGGCGCCAGGCCGTGG - Intergenic