ID: 1091263686

View in Genome Browser
Species Human (GRCh38)
Location 11:134253840-134253862
Sequence GCCGGAGTAGGGAGCCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 314}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091263686_1091263698 8 Left 1091263686 11:134253840-134253862 CCGGCCTGGCTCCCTACTCCGGC 0: 1
1: 0
2: 3
3: 25
4: 314
Right 1091263698 11:134253871-134253893 CCCGGCCTGGCTGCCCCCTCCGG 0: 1
1: 0
2: 6
3: 149
4: 2064
1091263686_1091263693 -5 Left 1091263686 11:134253840-134253862 CCGGCCTGGCTCCCTACTCCGGC 0: 1
1: 0
2: 3
3: 25
4: 314
Right 1091263693 11:134253858-134253880 CCGGCCGGTCACCCCCGGCCTGG 0: 1
1: 2
2: 3
3: 9
4: 176
1091263686_1091263708 27 Left 1091263686 11:134253840-134253862 CCGGCCTGGCTCCCTACTCCGGC 0: 1
1: 0
2: 3
3: 25
4: 314
Right 1091263708 11:134253890-134253912 CCGGTCGGTCACCACCATCCGGG 0: 1
1: 0
2: 0
3: 1
4: 53
1091263686_1091263706 26 Left 1091263686 11:134253840-134253862 CCGGCCTGGCTCCCTACTCCGGC 0: 1
1: 0
2: 3
3: 25
4: 314
Right 1091263706 11:134253889-134253911 TCCGGTCGGTCACCACCATCCGG 0: 1
1: 0
2: 0
3: 2
4: 33
1091263686_1091263691 -10 Left 1091263686 11:134253840-134253862 CCGGCCTGGCTCCCTACTCCGGC 0: 1
1: 0
2: 3
3: 25
4: 314
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263686_1091263700 12 Left 1091263686 11:134253840-134253862 CCGGCCTGGCTCCCTACTCCGGC 0: 1
1: 0
2: 3
3: 25
4: 314
Right 1091263700 11:134253875-134253897 GCCTGGCTGCCCCCTCCGGTCGG 0: 1
1: 0
2: 1
3: 53
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091263686 Original CRISPR GCCGGAGTAGGGAGCCAGGC CGG (reversed) Intronic
900438280 1:2641545-2641567 GCCTGTGCAGGCAGCCAGGCCGG - Exonic
900565979 1:3332040-3332062 TTCGGAGCAGGGAGCCTGGCAGG - Intronic
900735125 1:4294953-4294975 TCCTGGGTAGGGAGCCAGGGGGG + Intergenic
900792209 1:4688074-4688096 GCAGCAGTGGGGAGCCAGGATGG + Intronic
900869537 1:5292240-5292262 GCAGTAGTAGGGAGCAAGGATGG + Intergenic
901236353 1:7669616-7669638 GCTGGAGAAGGCCGCCAGGCAGG - Intronic
901242634 1:7704245-7704267 GACGGCGCGGGGAGCCAGGCAGG + Intronic
901443898 1:9295376-9295398 CCCCGAGCAGGGAGCAAGGCGGG + Intronic
902322150 1:15675630-15675652 GGCAGAGTAGGGAGGCAGGTAGG - Intergenic
903833508 1:26188705-26188727 GCTGGAGTTGGGAGCTGGGCTGG + Intronic
903942495 1:26941507-26941529 GCGGGAGAAGAGAGCCCGGCAGG + Exonic
904030049 1:27528056-27528078 GTTGGAGGAGGGAGCCCGGCCGG + Intergenic
905292872 1:36934881-36934903 GCCAGAGAGGGGAGCCAGGAGGG - Intronic
905300821 1:36985260-36985282 GCCAGAGGAGGGGGCAAGGCAGG - Intronic
905353056 1:37360682-37360704 GGAGGAGGAGGGAGACAGGCTGG - Intergenic
905356165 1:37386408-37386430 GCAGGACTAGGGAGGCAGGGCGG - Intergenic
905504364 1:38465487-38465509 GCAGGAGGAGGGGGCCACGCAGG - Intergenic
906529154 1:46513252-46513274 GCAGGTGCAGGGAGGCAGGCAGG - Exonic
907581646 1:55577798-55577820 GGTGGTGTATGGAGCCAGGCTGG + Intergenic
909629896 1:77759958-77759980 GTCAGAGTAGGGAGCCGGCCTGG - Intergenic
912387677 1:109280352-109280374 GGCGGGGTAGGGAGACAGGATGG + Intronic
916809866 1:168295982-168296004 CCAGGAGTAGCGAGTCAGGCCGG - Intronic
919382627 1:196877729-196877751 GCTGGAGTAGGGAGTTTGGCTGG + Intronic
921051687 1:211515709-211515731 GCCGGCGTAGTCAGCCGGGCGGG - Intergenic
921944931 1:220879868-220879890 GGCGTAGAAGGGAGCCAGCCCGG - Exonic
922774012 1:228206857-228206879 GAGGGAGGAGGGAGCCAGGACGG - Intronic
922902616 1:229148396-229148418 GCTGGAGGTGGGAGGCAGGCGGG - Intergenic
923430960 1:233919914-233919936 GCCGGAGTACAGAGCGAGGAAGG - Intronic
1062839756 10:661308-661330 GGTGGAGGAGGGAGCCAGGAAGG - Intronic
1063458455 10:6201429-6201451 GCCGGAGTGGGGGTCGAGGCGGG + Intronic
1068089119 10:52411046-52411068 GCCAGGGAGGGGAGCCAGGCCGG - Intergenic
1069782855 10:70967795-70967817 GCTGGTGTCTGGAGCCAGGCAGG - Intergenic
1070722481 10:78766165-78766187 GTCCGAGCAGGGAGACAGGCAGG + Intergenic
1070799101 10:79234747-79234769 GCCGGAGTAGGCTGACAGGTGGG - Intronic
1071155109 10:82678706-82678728 GTTGGAGTAGGTAGTCAGGCAGG - Intronic
1071259890 10:83910168-83910190 GAGGAAGCAGGGAGCCAGGCAGG + Intergenic
1072532755 10:96335108-96335130 GTGGGAGTAGGGAGCAAGCCTGG - Intronic
1075438907 10:122463928-122463950 GCAGCAGGAGTGAGCCAGGCTGG + Intronic
1075664416 10:124220596-124220618 GCCTCAGCAGGGAGTCAGGCGGG - Intergenic
1075744740 10:124718945-124718967 GGCTGAGTAGGGAGCCAGGAAGG + Intronic
1076356093 10:129854900-129854922 GCCAGGCTGGGGAGCCAGGCCGG - Intronic
1076372288 10:129963569-129963591 GCCGGCGGAGGGGGCCGGGCCGG + Intronic
1077186463 11:1237512-1237534 GGCTGAGCGGGGAGCCAGGCTGG - Intronic
1077323233 11:1951816-1951838 CCCGGAGCAGGGAGCCATGTGGG + Intronic
1080801940 11:35618147-35618169 GCCGGAGTCTGGGGCCTGGCGGG - Intergenic
1081629600 11:44680328-44680350 GGAGGAGTTGGGTGCCAGGCAGG + Intergenic
1082896961 11:58201974-58201996 GTCGGAGTTGGAAGCCAGGAAGG + Intergenic
1083300287 11:61736483-61736505 GGAGGGGTTGGGAGCCAGGCTGG - Intronic
1083653864 11:64219801-64219823 GCCAGAGTAGGCAGCCCTGCTGG + Intronic
1084857038 11:71996032-71996054 GCCTGAGTAGGAAGTGAGGCTGG + Intronic
1084993705 11:72954675-72954697 GGCTGAGTAGGTAACCAGGCTGG + Intronic
1085423158 11:76380908-76380930 GCCGGGGAGGGGAGCCAGGCCGG + Exonic
1086367039 11:86117621-86117643 GGCGGTGGAGGGAGCCAAGCAGG + Intergenic
1088673160 11:112164011-112164033 GCCAGAGTTGGCAGCCAGGAGGG + Exonic
1089350698 11:117820115-117820137 GACAGAGGAGGGAGACAGGCAGG + Exonic
1089455072 11:118621335-118621357 GCGGGGGAAGGGAGCCAGGGAGG - Intronic
1089560375 11:119340485-119340507 GCCGGGGTGGGGAGAGAGGCAGG - Intronic
1090780682 11:130003423-130003445 CCCGGAGTCGGGAGCCTGCCGGG + Intergenic
1091263686 11:134253840-134253862 GCCGGAGTAGGGAGCCAGGCCGG - Intronic
1091263699 11:134253872-134253894 ACCGGAGGGGGCAGCCAGGCCGG - Intronic
1202806219 11_KI270721v1_random:7011-7033 CCCGGAGCAGGGAGCCATGTGGG + Intergenic
1095561576 12:43572110-43572132 GCCGGAGAGGGGAGCCAGGCTGG + Intergenic
1095810693 12:46371593-46371615 GCCGGAGTAGGGGGCCTCGACGG - Intronic
1096062518 12:48713776-48713798 GCTGGGGTAGGGAGACAGGCAGG - Intronic
1096280175 12:50245935-50245957 GAAGGAGCAGGCAGCCAGGCCGG + Intronic
1099938145 12:89152902-89152924 GGCTGAGTGGGGACCCAGGCAGG - Intergenic
1100321037 12:93493222-93493244 GTCGGGGGAGGGAGGCAGGCAGG - Intronic
1100321637 12:93498776-93498798 GTCGGGGGAGGGAGGCAGGCAGG + Intronic
1100439448 12:94602664-94602686 CCCGGAGTTGGAAGCCAGCCTGG - Intronic
1100775158 12:97965669-97965691 GGCAGACTAGGGAGGCAGGCAGG + Intergenic
1101652884 12:106693751-106693773 GCCACAGTAGGGATCCTGGCTGG + Intronic
1102183475 12:110930767-110930789 GCCGGAGTAGGAAATGAGGCTGG - Intergenic
1102689253 12:114747608-114747630 GCCGGAGGAAGGGGCGAGGCAGG - Intergenic
1102954917 12:117053037-117053059 CCCTGAGGAGGGAGCTAGGCAGG - Intronic
1103925677 12:124422378-124422400 GCTGGAGCAAGGGGCCAGGCAGG + Intronic
1104674982 12:130706437-130706459 GGCAGAGTCTGGAGCCAGGCTGG - Intronic
1106070669 13:26407800-26407822 GCTGGGGTGGGGAGGCAGGCGGG - Intergenic
1106564778 13:30874713-30874735 GGCTCAGTAGCGAGCCAGGCTGG - Intergenic
1111889886 13:94068862-94068884 GCCCGTGAAGGGAGCCAGGAGGG - Intronic
1111957545 13:94775240-94775262 ACTGGAGTAAGGAGCCAAGCCGG - Intergenic
1113492887 13:110706118-110706140 GGCGGAGACGGGAGCCACGCCGG + Exonic
1114238361 14:20842347-20842369 GCTGGAGAAGGGAGCAAGGAAGG + Intergenic
1114634210 14:24178243-24178265 GCCGGGGAAGGGAGGGAGGCAGG + Intronic
1115955564 14:38775271-38775293 GGAGGAGGAGGGTGCCAGGCAGG - Intergenic
1118919784 14:70139517-70139539 GCTGGAGTGTGGAGCCAGCCAGG + Intronic
1119857400 14:77910765-77910787 GCCGGAGGGGGCAGCTAGGCTGG + Intronic
1120980263 14:90283081-90283103 GCGGGAGAAGGGAGCCTCGCAGG - Intronic
1122623086 14:103070749-103070771 CCAGGAGAGGGGAGCCAGGCTGG + Intergenic
1122924356 14:104892822-104892844 GCCGGTGTTTGGGGCCAGGCTGG + Intronic
1123037431 14:105477199-105477221 GCCTCCCTAGGGAGCCAGGCAGG - Intronic
1124690232 15:31815675-31815697 GCGGCAGGATGGAGCCAGGCTGG + Intronic
1125585030 15:40813861-40813883 GCAGGAGCAGTCAGCCAGGCAGG - Intronic
1128105955 15:65045068-65045090 CACGGAGCAGGGAGCCAGGCTGG - Intergenic
1128520307 15:68370573-68370595 GCCTGAGCAGAGAGCCAGACCGG - Intronic
1128904106 15:71452097-71452119 GCCAGAGCTGGGAGCCTGGCAGG - Intronic
1128998184 15:72312188-72312210 GCAGGAGGTGGGAGCCAGGTGGG + Intronic
1129155325 15:73713991-73714013 TGTGGAGCAGGGAGCCAGGCAGG - Exonic
1129171782 15:73812365-73812387 GCTGGGGCAGGCAGCCAGGCCGG - Intergenic
1129770790 15:78202127-78202149 ACCTGAGCAGGGAGCCAGGAAGG + Intronic
1130305339 15:82709449-82709471 GCCGCAGGAGGGGGCCGGGCGGG + Intronic
1132302966 15:100787828-100787850 GCTGCTGTGGGGAGCCAGGCAGG + Intergenic
1132779300 16:1614173-1614195 GGCGGCGCAGGGAGCGAGGCCGG + Intronic
1132783340 16:1640894-1640916 GCCTGAGGAGGGGGCCAGGCAGG + Intronic
1132871685 16:2118242-2118264 GCCGGAGCAGAGGGACAGGCAGG + Exonic
1132912753 16:2323862-2323884 GCAGGAGCAGGGAGCCACACAGG + Intronic
1133026347 16:2990505-2990527 TCAGGAGGAGGGAGGCAGGCAGG - Intergenic
1133089230 16:3390499-3390521 GCCTGAGGAGCAAGCCAGGCTGG + Exonic
1133232154 16:4371960-4371982 GGCGGCGCAGGGAGCCGGGCGGG - Exonic
1133464626 16:6018506-6018528 GCGGGAGTAGGTGGCCAGGAAGG + Intergenic
1134520844 16:14918653-14918675 GCCGGAGCAGAGGGACAGGCAGG - Intronic
1134550734 16:15137320-15137342 GCCGGAGCAGAGGGACAGGCAGG + Intronic
1134708514 16:16317304-16317326 GCCGGAGCAGAGGGACAGGCAGG - Intergenic
1134715729 16:16357337-16357359 GCCGGAGCAGAGGGACAGGCAGG - Intergenic
1134951088 16:18351341-18351363 GCCGGAGCAGAGGGACAGGCAGG + Intergenic
1134959028 16:18394822-18394844 GCCGGAGCAGAGGGACAGGCAGG + Intergenic
1136719678 16:32310244-32310266 TCCGGCGGTGGGAGCCAGGCCGG - Intergenic
1136838052 16:33516524-33516546 TCCGGCGGTGGGAGCCAGGCCGG - Intergenic
1137268448 16:46886735-46886757 GCTGGAGTTGGGAACCAGGAAGG + Intronic
1137686527 16:50390634-50390656 TCCGGAGCTGGGACCCAGGCAGG + Intergenic
1138553650 16:57760200-57760222 GCAGGAGCAGGGAGCTGGGCGGG - Intronic
1139493767 16:67301499-67301521 GCCTGGGTGGGGAGCCAGGCTGG - Intronic
1140228257 16:73096165-73096187 GCCGGAGCAGGCAGGCAGGCAGG - Intergenic
1140583950 16:76265556-76265578 ACAGGAGTAGGGAGCCTGGTTGG + Intergenic
1141182958 16:81766849-81766871 GTGGGAGAAGGGAACCAGGCTGG - Intronic
1141662510 16:85449052-85449074 GGCGCAGGAGGGAGCCGGGCTGG + Intergenic
1141992450 16:87618307-87618329 GCAGGAGGAGGGAGGGAGGCCGG + Intronic
1142146416 16:88494674-88494696 GCCTGAGTGGGGGGCGAGGCGGG + Intronic
1203006753 16_KI270728v1_random:207525-207547 TCCGGCGGTGGGAGCCAGGCCGG + Intergenic
1203133320 16_KI270728v1_random:1705518-1705540 TCCGGCGGTGGGAGCCAGGCCGG + Intergenic
1203148226 16_KI270728v1_random:1816804-1816826 TCCGGCGGTGGGAGCCAGGCCGG - Intergenic
1142606442 17:1083998-1084020 GCCGGAGCAGGGAGAGAGGGGGG + Intronic
1142611346 17:1110379-1110401 GCCGGTGAAGCGAGCCAGGTAGG + Intronic
1142635804 17:1256856-1256878 GCCGGAGAAAGAAGCCAGGAAGG - Intergenic
1143090891 17:4448626-4448648 CCCGGAGAAGGGGGCAAGGCTGG - Intronic
1143562746 17:7705264-7705286 GCCGGACCAGGGAGCGAGGAAGG - Exonic
1143962121 17:10729731-10729753 GGCGGAGCTGGGAGCCGGGCGGG + Intronic
1144829456 17:18123214-18123236 GGCGGAGCAGGCAGCCAGCCGGG + Intronic
1145249991 17:21292027-21292049 GCAGGAGCTGGGACCCAGGCTGG + Intronic
1145259302 17:21345265-21345287 GCCAGAGTGGGGAGTCAGGTGGG - Intergenic
1145317313 17:21742684-21742706 GCCAGAGTGGGGAGTCAGGTGGG + Intergenic
1146821436 17:35986114-35986136 GAGGGAGTAGAGAGGCAGGCTGG + Intronic
1147340745 17:39752008-39752030 GCCCAAGGAAGGAGCCAGGCAGG - Intergenic
1148581911 17:48750039-48750061 GCAGGAGTTGGGGGCCAGGTAGG + Intergenic
1150210835 17:63440625-63440647 CCCACAGCAGGGAGCCAGGCTGG - Intronic
1150389086 17:64780611-64780633 GCCGGGGTCCGGAGCCAGGAAGG + Intergenic
1150634375 17:66902627-66902649 GAAGGAGTAGGGAGAGAGGCTGG + Intergenic
1151232729 17:72696258-72696280 GCCGGGGTAAGGAGCCAGGTGGG - Intronic
1151351909 17:73536827-73536849 GGCGGAGTAGGGAAGGAGGCGGG - Intronic
1151987828 17:77555624-77555646 GCTGCAGGGGGGAGCCAGGCAGG - Intergenic
1152279589 17:79377611-79377633 GCCGGAGCAGGGAGCCAGAACGG + Intronic
1152626471 17:81390107-81390129 GCCCAAGCAGGGAGCCAGGTTGG - Intergenic
1152645850 17:81468227-81468249 GCCGGACTAGGGGTCCAGGTGGG + Intergenic
1154161095 18:11981391-11981413 GCGGGAGCAGGGAGCTGGGCGGG + Intronic
1154338627 18:13485319-13485341 CACGGAGTTGGGAGCCAGGAAGG + Intronic
1159935343 18:74361283-74361305 GGCGGAGTAGGGAGGGAGGAAGG + Intergenic
1160673071 19:375530-375552 TCGGGAGCAGCGAGCCAGGCCGG + Intronic
1161049404 19:2154777-2154799 GACTGACTGGGGAGCCAGGCAGG - Intronic
1161286316 19:3470165-3470187 GCTGGGGGAGGGAACCAGGCTGG - Intergenic
1161629393 19:5344768-5344790 GCTAGAGTAGGGAGACACGCAGG - Intergenic
1161684902 19:5697867-5697889 GCCGGAGGAGAGACCCTGGCGGG - Intronic
1162110202 19:8395918-8395940 GCCTGGGAAGTGAGCCAGGCAGG - Intronic
1163169307 19:15519639-15519661 AGGGGAGTAGGGAGCCATGCAGG + Intronic
1163183766 19:15622193-15622215 GCCAGAGAAGGGAGCAGGGCTGG - Intronic
1163697685 19:18772241-18772263 GGCTGAGTGGGGAGCCAGGCTGG - Intronic
1165958285 19:39515480-39515502 ACCGGAGTAGGGATCCAGGCCGG - Exonic
1166065551 19:40356412-40356434 GCTGGAGTGGGGACCCAGGTGGG + Intronic
1166790972 19:45398237-45398259 GCTGGAGTAGGGGGCGGGGCTGG - Intronic
1166978982 19:46621723-46621745 GTGGGAGGAGGGAGCCAGGGTGG - Intronic
1167375324 19:49108007-49108029 GCCGGAGTCGGGAGCGGGCCCGG + Exonic
1167466042 19:49651583-49651605 GCCGGAGGAGGAGCCCAGGCTGG + Exonic
1167593330 19:50415833-50415855 GCGGGAGCAGGCAGCCAGGTGGG - Intronic
1167868605 19:52348906-52348928 ACAGCAGTAGGGAGCTAGGCTGG - Intronic
925171711 2:1754234-1754256 GCAGGAGTGGGGAGGCCGGCTGG - Intergenic
925271198 2:2608778-2608800 GCCCGAGAAGGGAGCGATGCAGG + Intergenic
925287914 2:2727727-2727749 CCTGGAGGAGGGAGCCAGGTGGG + Intergenic
926162880 2:10501019-10501041 GCAGGAGAAGGGAGCCAAGGTGG - Intergenic
927749237 2:25651789-25651811 GCAGGAGAGGGGAGCCAGCCTGG - Intronic
927809698 2:26174075-26174097 GCCGGGGCTGGCAGCCAGGCCGG + Intronic
931455907 2:62409754-62409776 GGCAGAGCATGGAGCCAGGCTGG - Intergenic
933760008 2:85666573-85666595 GCCTGCGTGGGGAGGCAGGCAGG + Intronic
933777302 2:85778941-85778963 GCTGGAGGAGGCACCCAGGCTGG - Intronic
933777337 2:85779050-85779072 GCTGGAGGAGGCACCCAGGCTGG - Intronic
935692725 2:105745191-105745213 GGCGGAGTTGGGAGCGCGGCGGG + Intronic
938259224 2:129883317-129883339 TCGGGTGCAGGGAGCCAGGCAGG - Intergenic
940893493 2:159057707-159057729 GCTGGGGTGGGGAGCAAGGCAGG + Intronic
941003077 2:160221588-160221610 GCCCGGGGAGGGAACCAGGCTGG + Intronic
941491626 2:166149243-166149265 GCAGCAGCAGGCAGCCAGGCAGG + Intergenic
942748593 2:179264242-179264264 GCCGGAGGTGGGAGCCCTGCGGG - Intronic
944414629 2:199469441-199469463 GCAGGAGTAGTGAGCGATGCCGG - Intronic
947723237 2:232381650-232381672 GGCGGTGTAGGGCTCCAGGCAGG - Exonic
947727583 2:232409727-232409749 GGCGGTGTAGGGCTCCAGGCAGG - Exonic
948010171 2:234645930-234645952 GTGGGAGTAGGGAGGCAGTCGGG - Intergenic
948310480 2:236981983-236982005 GCTGGAGGAGGCAGCCAGGCTGG + Intergenic
948413402 2:237782513-237782535 GAAGGTGCAGGGAGCCAGGCAGG - Intronic
948492256 2:238320918-238320940 GCCGGAGTCGGGGCCCGGGCCGG + Intronic
948553454 2:238791464-238791486 GCCGGGGTAGGGGGGCAGGGTGG + Intergenic
948676787 2:239601540-239601562 GCCGGGGTGGGGAAGCAGGCAGG - Intergenic
948780535 2:240319071-240319093 GCTGGAGGAGGGGGCGAGGCTGG + Intergenic
1169122094 20:3102852-3102874 GCGGGAGTTGGGAGCAAAGCTGG - Intergenic
1171451054 20:25236664-25236686 GCCAGAGGAGGGAGACAGCCAGG + Intergenic
1172098896 20:32474039-32474061 GCTGGAGTAGGCTGCCTGGCAGG + Intronic
1172602812 20:36195511-36195533 GGCGGAGTGGGGAGCAAGGACGG - Intronic
1173221617 20:41137001-41137023 CCCGGACAAGGGAGCCAGGACGG - Exonic
1173226069 20:41163077-41163099 GTGGGAGTAGGGAACCATGCTGG + Intronic
1174506954 20:51023131-51023153 GCCGAGGGAGGGAGCGAGGCAGG + Intergenic
1176511269 21:7750449-7750471 GCAGGATCAGGGAGCCAGGAAGG + Intronic
1178645383 21:34380978-34381000 GCAGGATCAGGGAGCCAGGAAGG + Intronic
1179421237 21:41238395-41238417 GCAGGAGGAGGGAGGCAGGCAGG + Intronic
1179438664 21:41378872-41378894 GCAGGAGAGGGGAGCCAGGGAGG - Intronic
1179536229 21:42054592-42054614 GCTGGAGAAGGGAGCCAAGGTGG - Intergenic
1179630954 21:42678464-42678486 GCCCCAGTAGGAGGCCAGGCTGG + Intronic
1179802495 21:43817477-43817499 GTGGGAGGAGGGCGCCAGGCTGG - Intergenic
1179914414 21:44467112-44467134 GCCGGAGTGGGGATGCAGACAGG + Intergenic
1179965322 21:44801613-44801635 GCTGGGGCAGGGAGCCTGGCGGG - Intronic
1180738283 22:18034980-18035002 TCCCGAAGAGGGAGCCAGGCTGG - Intergenic
1181062827 22:20290173-20290195 GCCGGCCCAGGGAACCAGGCAGG + Intergenic
1181457972 22:23070389-23070411 GCGGGCGGAGGGAACCAGGCCGG + Exonic
1181512212 22:23394116-23394138 GCCGGGGGTGGGTGCCAGGCTGG + Intergenic
1181531616 22:23520664-23520686 GCCGCAGTGGGGGCCCAGGCTGG + Intergenic
1182331721 22:29555717-29555739 GCAGGGGGAGGGAGGCAGGCAGG + Exonic
1182443804 22:30379025-30379047 GCCCAGGAAGGGAGCCAGGCTGG + Exonic
1182462998 22:30495481-30495503 GATGGAGTAGGGACCCAGCCTGG - Intronic
1182475149 22:30573165-30573187 GGCGGAGCTGGGAGCCAGGGAGG + Intronic
1183069759 22:35387819-35387841 CTGGGAGTAGGGAGCCAGGAGGG - Intronic
1183219732 22:36504853-36504875 GCCGGCGGTTGGAGCCAGGCAGG - Intronic
1183779545 22:39989925-39989947 GAAGGAGGAGGGAGCCAGGCAGG + Intergenic
1183883379 22:40856365-40856387 GCCCCAGGGGGGAGCCAGGCTGG - Intronic
1183912936 22:41092396-41092418 GCCCGAGCCGAGAGCCAGGCTGG - Exonic
1184225608 22:43127528-43127550 GCCGGAGGAGGGATACAGGGAGG + Intronic
1184381044 22:44145138-44145160 GCAGGAGCATGGAGCCTGGCAGG - Intronic
1184459111 22:44627162-44627184 GCGAGAGAAGGAAGCCAGGCAGG + Intergenic
1184944579 22:47794073-47794095 GCAGGAGGTGGGAGCCAGGCAGG - Intergenic
1185117946 22:48948848-48948870 GCTGGAGGAGGGAGTGAGGCTGG - Intergenic
1185118032 22:48949137-48949159 GCTGGAGGAGGGAGTGAGGCTGG - Intergenic
1185118068 22:48949262-48949284 GCTGGAGGAGGGAGTGAGGCTGG - Intergenic
1185118073 22:48949280-48949302 GCTGGAGGAGGGAGTGAGGCTGG - Intergenic
1185125283 22:49007098-49007120 GGCAGCGTGGGGAGCCAGGCAGG + Intergenic
1185408955 22:50672874-50672896 GCGGGAGGAGGAAGCCAGACTGG + Intergenic
949980749 3:9500511-9500533 TCCAGAGTGGGGAGACAGGCAGG + Exonic
950446330 3:13040935-13040957 GCCGGAGTCCTGGGCCAGGCAGG - Intronic
952234856 3:31468600-31468622 GCCAGAGAAGGGAGCCTGGCAGG + Intergenic
954390896 3:50267496-50267518 GCTGGAGACGGCAGCCAGGCGGG - Intergenic
954447923 3:50556667-50556689 CCAGGAGTAGTGAGGCAGGCAGG + Intergenic
954574939 3:51670905-51670927 CCCGCAGTAGAGGGCCAGGCTGG - Intronic
961347095 3:126270365-126270387 GCCTGGGGAGGGTGCCAGGCTGG - Intergenic
961470766 3:127110136-127110158 GCCAGAGCAGGGGGCCAGGGAGG + Intergenic
962264598 3:133935879-133935901 GCTGGAGATGGCAGCCAGGCTGG + Exonic
963140382 3:141941930-141941952 CCTGGAGTAGTGAGCCAAGCTGG - Intergenic
968517296 4:1020700-1020722 GGCGGGGTGGGGACCCAGGCAGG + Intronic
968517311 4:1020729-1020751 GGCGGGGTGGGGACCCAGGCAGG + Intronic
968517344 4:1020793-1020815 GCTGGGGTGGGGACCCAGGCAGG + Intronic
968517359 4:1020822-1020844 GGCGGGGTGGGGACCCAGGCAGG + Intronic
968517374 4:1020851-1020873 GGCGGGGTGGGGACCCAGGCAGG + Intronic
968517420 4:1020943-1020965 GGCGGGGTGGGGACCCAGGCAGG + Intronic
968517435 4:1020972-1020994 GGCGGGGTGGGGACCCAGGCAGG + Intronic
968517450 4:1021001-1021023 GGCGGGGTGGGGACCCAGGCAGG + Intronic
968517465 4:1021030-1021052 GGCGGGGTGGGGACCCAGGCAGG + Intronic
968517480 4:1021059-1021081 GGCGGGGTGGGGACCCAGGCAGG + Intronic
968567537 4:1322124-1322146 GCCGGGCAAGGGAGCCAGGCTGG - Intronic
968576671 4:1369368-1369390 GCCGGAGGCGGGGACCAGGCGGG + Intronic
968581441 4:1397169-1397191 GCAGGGGTGGGCAGCCAGGCAGG - Intergenic
968619777 4:1598785-1598807 GCCGCAGGATGGAGCCCGGCGGG + Intergenic
968878992 4:3288950-3288972 GGCAGAGTGGGCAGCCAGGCTGG - Intergenic
969350151 4:6593599-6593621 GCCCGAGCCGGGAGCCAGCCCGG - Intronic
973981873 4:56314504-56314526 GCTGGAGGAGGACGCCAGGCTGG + Exonic
976114386 4:81711301-81711323 GCAGGAAAAGGGAGGCAGGCTGG + Intronic
976310548 4:83607519-83607541 GCAGGTGTAGGGGGCAAGGCTGG + Intergenic
980847012 4:138335782-138335804 GCCTCATTAGGGATCCAGGCAGG - Intergenic
981026126 4:140078549-140078571 GCTGGAGGAGGGAGCCTGGGCGG + Intronic
985660796 5:1155756-1155778 GCCGGGGTCGGGGGCCCGGCGGG + Intergenic
986721530 5:10564157-10564179 GCCAGAGTTCAGAGCCAGGCAGG - Intergenic
990822477 5:59858022-59858044 GAGGGAGTAGGGAGGCATGCAGG + Intronic
993639034 5:90380285-90380307 CCTTAAGTAGGGAGCCAGGCAGG + Intergenic
995134917 5:108670810-108670832 CCTGGAGAAGGGAGCCTGGCAGG + Intergenic
998094088 5:139387639-139387661 GCTGGAGGAGGGAGGCAGGATGG + Exonic
998132930 5:139660259-139660281 GGTGGAGTGTGGAGCCAGGCAGG + Intronic
998156375 5:139789058-139789080 GCCGGGGCAGGGAGCCACGGAGG - Intergenic
999722046 5:154405524-154405546 CCCTGAGGAGGGAGCCAGGCAGG + Intronic
1001413792 5:171528997-171529019 GCAGGAGTGGGGAGCCAGGCTGG - Intergenic
1001593522 5:172882762-172882784 ACAGGGGTAGGGAGGCAGGCTGG - Intronic
1001596542 5:172902360-172902382 GCCTGGGTTGTGAGCCAGGCTGG + Intronic
1002297692 5:178240497-178240519 GCCGGAGAGGGGCACCAGGCTGG - Intronic
1002817068 6:691018-691040 GCTGGACTAGGAACCCAGGCTGG + Intronic
1003459926 6:6320181-6320203 GCAGGAGTGGGGAGCCAAGCCGG + Intronic
1006717773 6:36131104-36131126 CAGGGAGTAGGAAGCCAGGCAGG - Intronic
1006814035 6:36839084-36839106 GGCAGAATAGGAAGCCAGGCTGG - Intronic
1011518544 6:88179525-88179547 GCAGGAGTAGGGGGACAGGGTGG - Intergenic
1015626327 6:135183047-135183069 GCAGGAGGAGGGAGTCGGGCAGG + Intronic
1016013545 6:139162483-139162505 GCCTGAGTTGGAATCCAGGCAGG - Intronic
1017761556 6:157573563-157573585 GGCGTAGGAGGGAGCCAGGGTGG - Intronic
1017789107 6:157780124-157780146 GGTGGAGGAGAGAGCCAGGCAGG - Intronic
1019177032 6:170165249-170165271 GCTGGAGTTGGGAGTCAGTCAGG + Intergenic
1019499133 7:1355673-1355695 GCTGCAGTGGGGAGCGAGGCTGG - Intergenic
1019530131 7:1499166-1499188 GCCAGAGGAGGGAGCGAGGAGGG + Intronic
1022220546 7:28309549-28309571 GCTGGTGTTGAGAGCCAGGCTGG + Intronic
1023221205 7:37921231-37921253 GCGGGAGTAGGGAGCCGCGCGGG + Intronic
1023998057 7:45174106-45174128 GCTGGAGGAGTGAGCCAGGAGGG + Intronic
1027053648 7:75035325-75035347 GCTAAAGTAGGGACCCAGGCCGG - Intronic
1028745130 7:94319265-94319287 CTAGGAATAGGGAGCCAGGCAGG - Intergenic
1029198462 7:98822903-98822925 GCCTGTGTAAGGGGCCAGGCTGG + Intergenic
1029477753 7:100795046-100795068 GGCAGGGTTGGGAGCCAGGCTGG + Intronic
1029485253 7:100836311-100836333 GGAGGAGCAGGAAGCCAGGCCGG + Intronic
1032306075 7:130733632-130733654 GCCGGAGGCGGGAGCCAGCTCGG + Exonic
1032429034 7:131846036-131846058 GCGGTGGCAGGGAGCCAGGCTGG + Intergenic
1032947413 7:136869733-136869755 GCTGGAATAGGGAGCGACGCCGG - Intronic
1033036327 7:137879341-137879363 GAGGGAGGAGGGGGCCAGGCAGG + Exonic
1033596782 7:142864614-142864636 GATGGAGTAGGGGGCCAGGCAGG + Exonic
1034243044 7:149624367-149624389 CCCGGAGTGGGGGGCCCGGCTGG + Intergenic
1034830532 7:154304384-154304406 TCCGGTGCAGGGAGCCAGGCAGG + Intronic
1035743905 8:1947787-1947809 GCAGCAGTAGGGAGGCGGGCGGG - Intronic
1036620625 8:10422755-10422777 GCTGCAGTAGGGAGCTGGGCCGG + Intronic
1037567599 8:20130639-20130661 GCAGGAGGAGGCAGCAAGGCTGG - Intergenic
1037700819 8:21272425-21272447 GCAGGAGAAGGCAGCCAGACAGG + Intergenic
1037757743 8:21722263-21722285 GCCAGGGAAGGGAGCCATGCAGG + Intronic
1038416769 8:27402433-27402455 TCTGGAGGAGGGAGCCAGGTTGG + Intronic
1041552771 8:59119521-59119543 GGCGGGGTAGGGAGCGCGGCCGG + Intergenic
1043303367 8:78762503-78762525 GCCGGGGAGGGGAGCCAGGCCGG + Intronic
1048327473 8:133450601-133450623 GCCGGGGTGGGGATCCAGGCAGG - Intergenic
1049580766 8:143409526-143409548 GGAGGGGTAGGGAGGCAGGCGGG + Intergenic
1053054265 9:34984910-34984932 GTCAGAGGAGGGAGGCAGGCCGG + Intergenic
1053288432 9:36864659-36864681 GCCGGAGGAGGCAGGCAGGCCGG - Intronic
1053434902 9:38068277-38068299 GCGGCAGCGGGGAGCCAGGCGGG - Exonic
1054729525 9:68686707-68686729 GCATGAGTTGGGAGGCAGGCTGG + Intergenic
1056841074 9:89998424-89998446 GCCGGAGAAGGAATCCAGGGTGG - Intergenic
1057361180 9:94374867-94374889 GCCCGAGGCGGGAGCCATGCCGG + Exonic
1057662183 9:97013297-97013319 GCCCGAGGCGGGAGCCATGCCGG - Exonic
1058860068 9:109107497-109107519 GGCAGAGGAGGGAGGCAGGCAGG - Intronic
1059819544 9:117956814-117956836 GCAGAAGTAGGCAGGCAGGCAGG + Intergenic
1060484206 9:124036954-124036976 GATGGAGAAGGGAGCCAGGGAGG + Intergenic
1060897053 9:127224981-127225003 GCTGGAGTTGGGAGCGGGGCCGG + Intronic
1061431912 9:130536513-130536535 GCCGGGTTGGGGAGCCAGGTGGG + Intergenic
1061962529 9:133995307-133995329 GGCGGAGGAGGGCACCAGGCAGG + Intergenic
1062008999 9:134257078-134257100 GCTGGAGTGGGCAGCCAGGGAGG + Intergenic
1062068907 9:134544721-134544743 GGCGGAACAGGGAGACAGGCAGG - Intergenic
1062707428 9:137953253-137953275 GTGGGAGCAGGAAGCCAGGCAGG - Intronic
1185566607 X:1099741-1099763 GTAGGTGAAGGGAGCCAGGCTGG + Intergenic
1189331579 X:40147679-40147701 GCGGGAGTAGAGAGCCAGGGAGG + Intronic
1198203188 X:134442280-134442302 GCCGGTGAAGAGAGCCGGGCAGG - Intergenic
1198484265 X:137070862-137070884 GGCTGAGCAGGGAGGCAGGCAGG - Intergenic
1200061201 X:153484571-153484593 GCCGCAGTGGGGAGGGAGGCGGG + Intronic
1200114572 X:153764573-153764595 GTGGGGGTGGGGAGCCAGGCGGG - Intronic
1200231996 X:154448722-154448744 GCAGGAGTGGGAAGCCAAGCAGG + Exonic
1201550636 Y:15213388-15213410 GGCAGAGGAGGGAGCCAGCCAGG + Intergenic