ID: 1091263691

View in Genome Browser
Species Human (GRCh38)
Location 11:134253853-134253875
Sequence CTACTCCGGCCGGTCACCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 49}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091263680_1091263691 -5 Left 1091263680 11:134253835-134253857 CCCCCCCGGCCTGGCTCCCTACT 0: 1
1: 0
2: 4
3: 45
4: 325
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263686_1091263691 -10 Left 1091263686 11:134253840-134253862 CCGGCCTGGCTCCCTACTCCGGC 0: 1
1: 0
2: 3
3: 25
4: 314
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263670_1091263691 25 Left 1091263670 11:134253805-134253827 CCCGGCGTCAGCTCCCCTTCCGG 0: 1
1: 0
2: 2
3: 68
4: 776
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263675_1091263691 10 Left 1091263675 11:134253820-134253842 CCTTCCGGCCAGTCACCCCCCCG 0: 1
1: 0
2: 1
3: 10
4: 240
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263682_1091263691 -7 Left 1091263682 11:134253837-134253859 CCCCCGGCCTGGCTCCCTACTCC 0: 1
1: 0
2: 5
3: 38
4: 397
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263683_1091263691 -8 Left 1091263683 11:134253838-134253860 CCCCGGCCTGGCTCCCTACTCCG 0: 1
1: 0
2: 0
3: 19
4: 232
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263673_1091263691 12 Left 1091263673 11:134253818-134253840 CCCCTTCCGGCCAGTCACCCCCC 0: 1
1: 0
2: 3
3: 17
4: 215
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263672_1091263691 24 Left 1091263672 11:134253806-134253828 CCGGCGTCAGCTCCCCTTCCGGC 0: 1
1: 0
2: 0
3: 4
4: 219
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263674_1091263691 11 Left 1091263674 11:134253819-134253841 CCCTTCCGGCCAGTCACCCCCCC 0: 1
1: 0
2: 2
3: 11
4: 186
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263677_1091263691 6 Left 1091263677 11:134253824-134253846 CCGGCCAGTCACCCCCCCGGCCT 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263669_1091263691 26 Left 1091263669 11:134253804-134253826 CCCCGGCGTCAGCTCCCCTTCCG 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263681_1091263691 -6 Left 1091263681 11:134253836-134253858 CCCCCCGGCCTGGCTCCCTACTC 0: 1
1: 0
2: 1
3: 35
4: 452
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263679_1091263691 2 Left 1091263679 11:134253828-134253850 CCAGTCACCCCCCCGGCCTGGCT 0: 1
1: 0
2: 1
3: 31
4: 276
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1091263684_1091263691 -9 Left 1091263684 11:134253839-134253861 CCCGGCCTGGCTCCCTACTCCGG 0: 1
1: 0
2: 1
3: 37
4: 282
Right 1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091263691 Original CRISPR CTACTCCGGCCGGTCACCCC CGG Intronic
905390909 1:37634803-37634825 CTACTCTGGCCGGTCGCTCCGGG + Exonic
906211888 1:44016729-44016751 CACCTCCGGCCCGTCTCCCCGGG + Intronic
906380059 1:45327051-45327073 CAACTCCGGACGATCAGCCCAGG + Exonic
1063138104 10:3234728-3234750 CTTCACCGGCAGGTCACCCCTGG + Intergenic
1083126239 11:60568780-60568802 CTACTCCCGCCCTTCACCCTTGG - Intergenic
1084444700 11:69196849-69196871 CTGCTCCGGCCGGGCCACCCTGG - Intergenic
1085346186 11:75769356-75769378 CCACTGCGGCTGGTGACCCCTGG + Intronic
1085641346 11:78195056-78195078 CCACACCGGCCTGTCACCCTTGG - Intronic
1087795546 11:102452376-102452398 CCACCCCGCCCGGTCACCTCTGG + Intronic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1091263790 11:134254081-134254103 CTCCTGCGGCCGGTCACCCTCGG + Intronic
1091781900 12:3219108-3219130 CTACACCGTCCGGCCTCCCCCGG - Intronic
1091980453 12:4860228-4860250 CTCCTCCCTCCAGTCACCCCAGG + Intergenic
1094631899 12:32183950-32183972 CTAGTCCAGCCCGTCACCACTGG + Intronic
1105349467 13:19602315-19602337 CGACCCCGGCGGGCCACCCCGGG - Intergenic
1107338294 13:39379608-39379630 CTACCCCAGTCAGTCACCCCTGG + Intronic
1110561781 13:76917637-76917659 CTACTCCTGCCTGGCACCTCAGG + Intergenic
1128145788 15:65331863-65331885 CTACTCAGGCCACTCACTCCAGG + Intronic
1133723040 16:8512723-8512745 CTCCTCCAGCCTCTCACCCCAGG + Intergenic
1134327741 16:13222311-13222333 CTACTCCGAGTGGTCACTCCAGG + Intronic
1138497249 16:57416106-57416128 CCACTCCGGCCTGTCACTCTGGG + Intergenic
1141736494 16:85857642-85857664 CCTCTCCTGCCGGCCACCCCAGG - Intergenic
1141764071 16:86047121-86047143 CTCATCCTGCCGGTCACCCCAGG - Intergenic
1148218291 17:45845785-45845807 CTACAGCTGCCTGTCACCCCTGG + Exonic
1152353408 17:79795468-79795490 CTACCCTGGCCGCTCGCCCCAGG - Exonic
1159455887 18:68659878-68659900 CTACTCTGACCGGTGACCACAGG - Intergenic
1161123070 19:2540737-2540759 TTGCTCCGGCAGGTCTCCCCGGG - Intronic
1163143949 19:15368500-15368522 CTACTCCGGGCTCTCACTCCAGG - Intronic
1165463380 19:35958060-35958082 CTGCTCTGGCAGGTGACCCCCGG + Intergenic
1167498560 19:49832856-49832878 CTCTTCCGGCCGGTAACCCCAGG + Intronic
927987446 2:27422458-27422480 CCACTGCGCCCGGTCACACCAGG - Intergenic
928432898 2:31234894-31234916 CTAGTCCCTCCGGTCACTCCTGG + Intronic
932446925 2:71787049-71787071 CTGCTCCAGGAGGTCACCCCTGG + Intergenic
946860728 2:223998098-223998120 ATACTGCGGCCACTCACCCCTGG + Exonic
948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG + Intergenic
948642886 2:239386480-239386502 CTCCCCTGGCCGGCCACCCCGGG - Intronic
1174176572 20:48649266-48649288 CTGCTCACGCCGGACACCCCCGG + Intronic
1182014193 22:27025471-27025493 CTCCCCTGGCCGGTCACCCAGGG - Intergenic
952644497 3:35639364-35639386 CTGCTCTGGCCGGAGACCCCGGG - Intronic
964743271 3:159988885-159988907 CGGCTGCGGCCGGGCACCCCGGG + Exonic
968957877 4:3728323-3728345 CTCCCCCTGCCAGTCACCCCCGG + Intergenic
975683265 4:76896986-76897008 CAGCTCCGGCCGGTCTCCGCGGG + Exonic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
996536844 5:124586202-124586224 CTACTGCGGCAGGTAAGCCCAGG + Intergenic
1012625485 6:101399686-101399708 CCACTCCCGCCTGTCTCCCCCGG + Intronic
1018046362 6:159969434-159969456 CCACGCCGGCCGCTCACCCCGGG - Intronic
1022691870 7:32663972-32663994 CTACTCCTCCCCCTCACCCCTGG - Intergenic
1022919532 7:34998513-34998535 CTACTCCTCCCCCTCACCCCTGG - Intronic
1024284940 7:47748807-47748829 CAACTCCGCCCAGTGACCCCTGG + Intronic
1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG + Exonic
1045003207 8:97896068-97896090 CTGCTGCAGCCGGTCACACCTGG + Intronic
1049628121 8:143635885-143635907 CCGCTCCTGCCGGACACCCCTGG + Intergenic
1049832829 8:144713241-144713263 GCACTGCGGCCGGTGACCCCGGG - Intergenic
1060407997 9:123382150-123382172 CTGCTCCAGCCGCTCAGCCCTGG - Exonic
1060588280 9:124800251-124800273 CTCCTCTGGCCAGTCACCCTTGG + Intronic
1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG + Intronic