ID: 1091273660

View in Genome Browser
Species Human (GRCh38)
Location 11:134335037-134335059
Sequence GATGCTGGCTGCCCACATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091273660_1091273661 -9 Left 1091273660 11:134335037-134335059 CCTTCATGTGGGCAGCCAGCATC 0: 1
1: 0
2: 1
3: 32
4: 236
Right 1091273661 11:134335051-134335073 GCCAGCATCATGCTCCTAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 91
1091273660_1091273664 13 Left 1091273660 11:134335037-134335059 CCTTCATGTGGGCAGCCAGCATC 0: 1
1: 0
2: 1
3: 32
4: 236
Right 1091273664 11:134335073-134335095 GTAAGTTCATTTCTTCTCTGAGG 0: 1
1: 0
2: 1
3: 21
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091273660 Original CRISPR GATGCTGGCTGCCCACATGA AGG (reversed) Intronic
901444934 1:9302463-9302485 GATGGTGCCTGCCCACATGGAGG - Intronic
901771099 1:11530770-11530792 GTTGCAGGCTGCCAACATGAGGG + Intronic
902146558 1:14405906-14405928 GATGAGGCCTGCCCACATTAGGG + Intergenic
904384511 1:30132586-30132608 CGTGGTGGCTGCCCACCTGAAGG - Intergenic
904590069 1:31608597-31608619 GCTGCTGGCGGCCGACAGGATGG + Intergenic
908632969 1:66130635-66130657 GATGCAGGCTGCCCCCAGGAAGG - Intronic
912701129 1:111878922-111878944 GATGAGGCCTGCCCACATTAGGG - Intronic
912724673 1:112048378-112048400 GATGAGGGCTGCCCACATTAGGG - Intergenic
913041395 1:115028452-115028474 AATGCTGTCTGCCCACATTGAGG + Intergenic
916680935 1:167104462-167104484 GATGCTTGCTCGCCACAGGAAGG - Intronic
919310103 1:195896182-195896204 GATACTGCCTGCCCATATTAAGG + Intergenic
919972410 1:202589809-202589831 GATGGGAGCTGCCCACCTGAGGG - Exonic
921700676 1:218265453-218265475 GATGGTGCCTACCCACATTAAGG + Intergenic
921980857 1:221257268-221257290 GATGCTGGTAGCTCACATCAGGG + Intergenic
922206779 1:223455074-223455096 AATGCTGGCTGGTCACAGGAAGG + Intergenic
923197160 1:231679327-231679349 GGTGCTGGCTGCTCCCCTGAGGG - Intronic
923385546 1:233462202-233462224 GATGGTGCCTGCCCACATTGAGG + Intergenic
924381634 1:243470761-243470783 GATGCTGTCTTGCCACAGGAGGG - Intronic
1065624628 10:27617912-27617934 CAAGCTGGCTGCCCCCTTGAAGG - Intergenic
1066012423 10:31207075-31207097 GAGGCTGTCTGCCTATATGATGG + Intergenic
1067099962 10:43327494-43327516 AATGGTGGCTGCCCACATTGAGG - Intergenic
1070685193 10:78475409-78475431 GATGCTGGATGGTCACTTGACGG + Intergenic
1071831021 10:89372240-89372262 GATGCTGGCTGCACACACTAGGG - Intronic
1072010773 10:91301224-91301246 GATGGTGCCTGCCCACATTGAGG + Intergenic
1074573797 10:114649674-114649696 GATGAAGGCTGCCAACAGGAAGG - Intronic
1075679175 10:124320394-124320416 AATGCTGGCTGCCCACAACATGG + Intergenic
1077367480 11:2167028-2167050 GAGCCTGGCTGCCCGCAGGAAGG - Exonic
1077601155 11:3575862-3575884 GATGCTGGTGACTCACATGACGG - Intergenic
1080714330 11:34784117-34784139 GATGCTGGGTGCACAGATCATGG + Intergenic
1084257074 11:67950437-67950459 GATGCTGGTGACTCACATGACGG - Intergenic
1084815704 11:71644831-71644853 GATGCTGGTGACTCACATGACGG + Intergenic
1085389013 11:76172690-76172712 GATGCTGGCTGCCCAGCCCAGGG - Intergenic
1086349994 11:85935413-85935435 GACGCTGGCTGTGCACACGATGG - Intergenic
1087273611 11:96138581-96138603 AATGCTGGCTGACCACTTGGGGG - Intronic
1088424816 11:109691924-109691946 GACGCAGGCTGCCCCCAAGATGG + Intergenic
1089390847 11:118100636-118100658 GACCTTGGTTGCCCACATGATGG + Intronic
1089646163 11:119880479-119880501 GCTGCTGGCTGCCCAGAGGTAGG + Intergenic
1090056789 11:123430792-123430814 CATGCCGGCGGCCAACATGATGG + Exonic
1090372163 11:126263921-126263943 TGTGGTGGCTGCCCTCATGAAGG - Exonic
1090577719 11:128125981-128126003 GATGGTGCCTGCCCACATGGAGG - Intergenic
1090917292 11:131176888-131176910 GGTGGTAGCTGCCCACATGAAGG + Intergenic
1091273660 11:134335037-134335059 GATGCTGGCTGCCCACATGAAGG - Intronic
1092427307 12:8385221-8385243 GATGCTGGTGACTCACATGACGG - Intergenic
1093119852 12:15255841-15255863 AATTCTGCCTGCCCACAAGAGGG - Intronic
1094102094 12:26775669-26775691 GATGGTGCCTGCCCAGATTAAGG - Intronic
1097232657 12:57522096-57522118 AACTCTGGCTGCCCCCATGAGGG - Intronic
1097307332 12:58083977-58083999 GATGCAGGTTGGCCACATGAGGG + Intergenic
1098081747 12:66793673-66793695 GATGGAGGCTGCCATCATGAAGG + Intronic
1099879778 12:88454373-88454395 GATGGTGCCTCCCCACATTAAGG + Intergenic
1100070390 12:90709266-90709288 GATGGTGTCTGCTCACATGGAGG + Intergenic
1101337050 12:103805970-103805992 GATGCTGGCTGGCAAGCTGAGGG - Intronic
1104998438 12:132673664-132673686 GATTATGACTGCCCACAGGAAGG + Exonic
1106051881 13:26198351-26198373 GATGAGGCCTGCCCACATTATGG + Intronic
1106540618 13:30686888-30686910 GTTGCAGGCTGCCCAAAGGAGGG + Intergenic
1108181088 13:47840770-47840792 GCTGATGGCATCCCACATGAAGG + Intergenic
1108455723 13:50611841-50611863 CATGGGGGCTGCCCACAGGATGG + Intronic
1110010878 13:70331937-70331959 GATGGTGTCTACCCACATCAAGG - Intergenic
1111431983 13:88157260-88157282 TATGGTGTCTGCCCACATGAAGG + Intergenic
1112758493 13:102667787-102667809 GATCCTGGCTGCCCAGAGAAGGG - Intronic
1113597234 13:111541891-111541913 GATGCTGGCTGTCCTCACTAAGG + Intergenic
1114221948 14:20704567-20704589 GCTGCTGCATGCACACATGAGGG - Intergenic
1115278209 14:31631799-31631821 GATGATGCCCACCCACATGAAGG + Intronic
1121180471 14:91925250-91925272 GATGCTGGCTGCCTGCAGCAGGG + Intronic
1121589630 14:95093606-95093628 AATGCTGGAAGCCCTCATGAAGG + Intronic
1121698492 14:95932679-95932701 GAGGCTGGCTGTCAAGATGATGG - Intergenic
1122128146 14:99590258-99590280 GATGCTGCCTGCCCTCCTGCTGG - Intronic
1124609473 15:31198434-31198456 GATGCTGGCTGACAGCAAGATGG - Intergenic
1124634797 15:31358116-31358138 GATGCTGGCTGCCCAACAGCTGG - Intronic
1125373016 15:38998853-38998875 GATGCTGGATGGCCACAACAAGG + Intergenic
1125606753 15:40943836-40943858 GATGCTGGTTACCATCATGAGGG - Intergenic
1125611262 15:40972462-40972484 GATGAGGCCTGCCCACATTAGGG + Intergenic
1130029263 15:80296723-80296745 GATGATGGCTGCCCACATTGAGG + Intergenic
1132569640 16:638504-638526 GACGCAGGCTGCACAGATGACGG + Intronic
1133310980 16:4846948-4846970 GATACTGGCGGCCCCCGTGAAGG - Intronic
1135302187 16:21340134-21340156 GATGATGCCTGCCCACATTGGGG + Intergenic
1136616219 16:31400149-31400171 GATGTTGGCTGCCCAGATGTGGG + Intronic
1137479113 16:48836563-48836585 GGTGCTTGCTGCTCACATGCAGG - Intergenic
1138239914 16:55419115-55419137 CACTCTGGCTGCCCTCATGAAGG - Intronic
1139300672 16:65942754-65942776 GAAGCTCAGTGCCCACATGAGGG + Intergenic
1139635484 16:68255839-68255861 GGTGCTGGTTGCCCACAGTATGG + Exonic
1140257048 16:73346361-73346383 GATGCTGCCTGCCCAGACAAAGG - Intergenic
1142866461 17:2794468-2794490 GCTGCTGGCTTCCCACAGGATGG - Intronic
1143020566 17:3915311-3915333 GGTGCTGAGTGCCCACATGTGGG - Intronic
1145796496 17:27658640-27658662 GACTCTGGCTCCCCACATGCTGG + Intergenic
1145810931 17:27763915-27763937 GACTCTGGCTCCCCACATGCTGG + Intronic
1146741322 17:35286230-35286252 AATGCTGCCTGCCCACATTTAGG - Intergenic
1146898907 17:36568260-36568282 GATGCTGGCTTAACACAAGAAGG - Intronic
1147347580 17:39812502-39812524 TATGCTGGCTGACTCCATGATGG - Intronic
1148629396 17:49095242-49095264 GATGGTGCCTGCCCACATCAAGG - Intergenic
1152602450 17:81271290-81271312 GATGCTGGCTGCGCACGGCACGG + Intronic
1153103281 18:1498561-1498583 GATGATGCCTGCCCATATTATGG + Intergenic
1156011459 18:32501778-32501800 GCTGCTGGCAGCCCTCCTGAAGG + Intergenic
1156536706 18:37871332-37871354 AAAGCAGGCTGCCCACAAGATGG - Intergenic
1157335609 18:46734995-46735017 GATGGTGCCTACCCACATTAAGG - Intronic
1157495780 18:48156286-48156308 GATGCTGGCAGCCAAGAGGAGGG + Intronic
1158543845 18:58379268-58379290 GATGCTGTCCACCCTCATGACGG + Intronic
1158940035 18:62399351-62399373 GACGCTTTCTGGCCACATGATGG + Intergenic
1160527418 18:79545765-79545787 GAGGCTGGCTGCACGCAGGAGGG + Intergenic
1161043452 19:2122080-2122102 GGTGCAGGCTGCCCCCATGCCGG + Intronic
1161737412 19:5999943-5999965 GGTGCTGGCTGGCCAGCTGAGGG + Intronic
1161915386 19:7224501-7224523 GAGGCTCGCTGCCCCCATGGCGG - Intronic
1162442199 19:10699811-10699833 GATGCCGGTTGCCCAGATGGTGG - Intergenic
1162622040 19:11851259-11851281 GATGCTGTCAGCCCACATGCAGG - Intronic
1162626877 19:11891580-11891602 GATGCTGTCAGCCCCCATGCAGG - Intronic
1164566156 19:29327457-29327479 TCTGCTGAGTGCCCACATGAAGG - Intergenic
1164825021 19:31278574-31278596 GGAGCTCACTGCCCACATGATGG - Exonic
1167288647 19:48612904-48612926 GATCCAGGCTGCCCACAAGGTGG - Exonic
925638016 2:5960547-5960569 TATTCTGGCTCTCCACATGAAGG + Intergenic
925690556 2:6518608-6518630 GATGAGGCCTGCCCACATTAGGG + Intergenic
926298451 2:11585232-11585254 GATGGTGGCTGCCCCCAAGGTGG + Exonic
927039910 2:19218448-19218470 AATGAGGACTGCCCACATGATGG - Intergenic
927395562 2:22646628-22646650 GATGATGCCTGCCCACATTGGGG - Intergenic
929889264 2:45905922-45905944 TATGGTGTCTGCCCACATGAAGG + Intronic
929937277 2:46302563-46302585 CATGCTGCCTGTTCACATGATGG + Intronic
931700019 2:64901921-64901943 GCTGCTGGGTGCACAGATGAGGG - Intergenic
932048098 2:68370345-68370367 GATGCTGGGTGTACACAAGAAGG + Intronic
932750311 2:74367351-74367373 GCAGCTGGCTGACCACATTAAGG - Exonic
935815079 2:106839707-106839729 GATCTTGGTTTCCCACATGAAGG + Intronic
935827691 2:106968109-106968131 GATGCAGGCTGCCCTCAAGGAGG + Intergenic
935957415 2:108391224-108391246 CATGCAGGCAGCCCACCTGAAGG + Intergenic
936610212 2:113995180-113995202 GATGGTGCCTGCTCACATGTGGG + Intergenic
936646063 2:114374413-114374435 GATGGTGCCTGCCCACATTGAGG + Intergenic
938420687 2:131143962-131143984 AATGCTTGCCGCCCACATAAGGG + Intronic
938553205 2:132399648-132399670 GATCCAGGCTGCCCTCAGGAGGG + Intergenic
939473220 2:142651933-142651955 GATGGTGCTTGCCCACATGGAGG + Intergenic
940583215 2:155607959-155607981 GATAAAGGCTGCCCACATTAAGG + Intergenic
942987445 2:182160373-182160395 GATGGTGCCTGCCCACATTGAGG - Intronic
943826441 2:192399756-192399778 GATGCTGGCTTCACACAACAGGG + Intergenic
946875676 2:224127243-224127265 AATGCTGTCTGCCCATATTATGG + Intergenic
947100534 2:226616510-226616532 GATGCTGGCTTTCAAGATGAAGG - Intergenic
947745804 2:232506758-232506780 GAAGCAGGCTGCCCACAGAAGGG - Intergenic
1172452821 20:35040312-35040334 GATGGTGCCTGCCCACATTGAGG - Intronic
1175571328 20:60024984-60025006 CAGGCTGGCTGCCGACCTGAAGG + Intronic
1175675853 20:60945995-60946017 GATGATGGCTGCAGAGATGATGG + Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1177660217 21:24073210-24073232 GAAGCTTACTGCCCTCATGAAGG - Intergenic
1177841343 21:26237007-26237029 AATGCTGGGTGCTCACTTGATGG + Intergenic
1178077935 21:29029701-29029723 CATGCTGTCTCCCCAGATGATGG - Intronic
1179249006 21:39657296-39657318 GATGGTGCCTGCCCACATGGAGG - Intronic
1179478027 21:41660207-41660229 AATCAGGGCTGCCCACATGAGGG - Intergenic
1181275400 22:21684856-21684878 GATTCTGGCAGCCACCATGAAGG + Exonic
1182314882 22:29439082-29439104 GAGGCTGGCTTCCCACATCAAGG + Exonic
1182695067 22:32192962-32192984 GAGGCTGGCTTCCCACATCAAGG - Exonic
1182716287 22:32358362-32358384 GAGGCTGGTTTCCCACATCAAGG + Exonic
1184269950 22:43374374-43374396 GATGGTGCCTGCCCACATTGGGG + Intergenic
1184452247 22:44590297-44590319 GAGGCTGGCTGCCCTCATGAGGG - Intergenic
1184666278 22:45990753-45990775 GACCCTGGCTGCCCACCTGAAGG - Intergenic
1184672383 22:46021596-46021618 GCTGCTGGCTGCCACCTTGAAGG + Intergenic
949907075 3:8866568-8866590 GTTGCTGGCTGTGCAGATGAAGG + Intronic
950152523 3:10698670-10698692 GGAGCTGGCTTCCCACAAGATGG + Intronic
950750488 3:15124284-15124306 GATGCTGGTGACTCACATGACGG + Intergenic
951382104 3:21996184-21996206 GCTGCTGGGAGTCCACATGATGG - Intronic
951884334 3:27509454-27509476 GATGCTGGCTGTCCCCAGGGAGG - Intergenic
953500511 3:43428468-43428490 ATTGCTGTCTGCCCACTTGATGG + Intronic
954431783 3:50474695-50474717 GGTGCTGGCTGCACACATCAGGG + Intronic
955525048 3:59811382-59811404 CATGCAGGATGCCCACATGCTGG - Intronic
955847417 3:63180413-63180435 GATGATGGCTGCCCCCTTGCAGG - Intergenic
957050506 3:75408169-75408191 CTTGCTGGCTGCCAACATTAAGG + Intergenic
957587013 3:82145937-82145959 GATGGTGCCTGCCCATATAAGGG - Intergenic
959335190 3:105055619-105055641 GATGGGGCCTGCCCACATTAAGG - Intergenic
959847660 3:111053423-111053445 GATGGTGCCTGCCGACATGGAGG - Intergenic
960475497 3:118119489-118119511 GATGCTGTCAGTTCACATGAAGG + Intergenic
961282126 3:125772171-125772193 GATGCTGGTGACTCACATGACGG + Intergenic
961678768 3:128584587-128584609 AGTGGTGGCTGCCCCCATGAGGG + Intergenic
961882805 3:130074609-130074631 CTTGCTGGCTGCCAACATTAAGG + Intergenic
962954417 3:140251045-140251067 TATGTTGGCCGCCCACATGTGGG + Intronic
963312200 3:143721358-143721380 CCTCCTGTCTGCCCACATGAGGG - Intronic
964503846 3:157377090-157377112 AAGGCTGGCTGTCCACACGAGGG + Intronic
964739931 3:159954491-159954513 GATGATGGCTGCCCACATTGGGG + Intergenic
968753025 4:2400038-2400060 GATGCTGCCTCTCCACATGGAGG + Intronic
969272485 4:6112336-6112358 AATGCTGTCTGACCACATGCAGG + Intronic
969292253 4:6247545-6247567 GATGGTGCCTACCCAGATGAAGG + Intergenic
971942877 4:33238367-33238389 GATGGTGGATGCCCTGATGATGG - Intergenic
972403188 4:38724092-38724114 GACTCTTCCTGCCCACATGAAGG - Intergenic
973779770 4:54277370-54277392 GATTCTGCCTGCCCACAGGTCGG + Exonic
975761444 4:77624395-77624417 GATGCGGGCTGCTCCCAGGAAGG - Intergenic
976248977 4:83031613-83031635 GATGGTGCCTGCCCACACTAAGG + Intergenic
976733931 4:88291660-88291682 ACAGCAGGCTGCCCACATGAGGG + Intergenic
976815303 4:89140555-89140577 GATGATGTCTGCCCACACTAAGG + Intergenic
978325895 4:107553886-107553908 GATGCTGCCTGCTTTCATGATGG - Intergenic
979223796 4:118261764-118261786 TCTGTTGGCTCCCCACATGAGGG - Intergenic
979639488 4:122996969-122996991 GATGGTGCCTGCCCACATTGAGG + Intronic
980891653 4:138821788-138821810 GATCCTGGCTCACCTCATGATGG - Intergenic
983049119 4:163023405-163023427 GATGGTGCCTGCCCAGATTAAGG - Intergenic
985095398 4:186407905-186407927 GATACTGGGCGGCCACATGAAGG - Intergenic
985106359 4:186503923-186503945 GATGAAGGCTGCCCACATAATGG + Intronic
985416357 4:189739542-189739564 TTTGCTTGCTTCCCACATGATGG - Intergenic
985552581 5:541127-541149 GAGGCGGGCAGCCCACTTGATGG - Intergenic
985922548 5:2990093-2990115 GATGCTGGCAGTCCAGTTGACGG + Intergenic
986447905 5:7838900-7838922 GAGGGTGGCTGCCCACCTGCAGG - Intronic
986916196 5:12623868-12623890 AATTCTGGCTCCCCACATGTGGG + Intergenic
987546362 5:19315122-19315144 GATGATGCCTGCCCATATTAAGG + Intergenic
988416740 5:30955026-30955048 GGGGGTGGCTGCCCTCATGATGG + Intergenic
989452049 5:41597839-41597861 GATGGTGCCTGCCCACATTGAGG + Intergenic
990282917 5:54270896-54270918 GATGGTGCCTGCCCACATTGAGG - Intronic
990833840 5:59991973-59991995 GATGGTGCCTACCCACATGGAGG - Intronic
991367257 5:65882326-65882348 GATGCAGGCTGCCCCCAGGGAGG - Intergenic
992284134 5:75215240-75215262 GATGAGGCCTACCCACATGATGG + Intronic
992413273 5:76528478-76528500 GATGCTGGTTGACCCCATCAAGG - Intronic
996976498 5:129440689-129440711 GATGGTGCCTGCCCACATTGAGG + Intergenic
998504853 5:142664212-142664234 CAAGCTGGCTGCCCACCTGAAGG + Intronic
1000225531 5:159257635-159257657 GATGGTGCCTGCCCACATTGCGG - Intergenic
1000398616 5:160801968-160801990 GATGCAGGCAGCAAACATGATGG + Intronic
1001139106 5:169128782-169128804 CATGTTGGCTGGCAACATGAAGG - Intronic
1002781467 6:369989-370011 TATGCTCCCTGCCCACATGGAGG - Intergenic
1002985927 6:2190903-2190925 GGTCCTGCCTGGCCACATGAGGG - Intronic
1006300522 6:33191583-33191605 GGGGCTGGCTGCCAACAGGACGG - Intronic
1006576483 6:35050062-35050084 GATTCTGGCTGCCCACGGGGTGG - Intronic
1006980790 6:38146173-38146195 GATGCTGTCTGCTCACTTGAAGG + Intronic
1007228515 6:40331540-40331562 GATGCTGGCTGCCTTCAGGGTGG - Intergenic
1007239721 6:40416379-40416401 GATGTTGGCTGACCTCATGCAGG - Intronic
1007782324 6:44261722-44261744 GGCGCTGGCAGGCCACATGAAGG + Exonic
1007825161 6:44594758-44594780 GCTGCTGGCTGGCCCCAGGACGG - Intergenic
1009966787 6:70586578-70586600 GAAACTGTCTGCCCACAGGATGG + Intronic
1010121890 6:72386350-72386372 GTTGCTGGCAGTCCAGATGACGG - Intronic
1011617252 6:89208549-89208571 GATGGGGGCTCCCCACATGATGG - Intronic
1015467382 6:133561994-133562016 GATGGTGGCCACCCAGATGAAGG + Intergenic
1015849871 6:137560556-137560578 ACTGCTGGCTGCCCTCCTGAAGG + Intergenic
1016012864 6:139157054-139157076 GCTGCTGGTTGCCCACTTTATGG + Intronic
1016836824 6:148485827-148485849 GAACCTGCCTGCCCACGTGATGG - Intronic
1017822690 6:158060679-158060701 GATGCTGGCTGCTAATTTGAAGG + Intronic
1018464499 6:164031228-164031250 GATGCTGCCTCCCCGCCTGAAGG - Intergenic
1018746370 6:166765163-166765185 CATGCTGGCTGGCCACGTGGAGG - Intronic
1019751731 7:2734973-2734995 CACGCTGGCTTCCCACATCACGG - Intronic
1020497623 7:8876146-8876168 GATGGGGCCTGCCCACATTATGG + Intergenic
1022316449 7:29249427-29249449 GATGGTGCCTGCCCACATGGAGG + Intronic
1022620912 7:31983960-31983982 GCTGCAGGCTGCCCAAATGAAGG + Intronic
1022627302 7:32051016-32051038 GAGGCAGGCTGGGCACATGAGGG + Intronic
1026391342 7:69905628-69905650 CATGGTGCCTGCCCACATGGAGG + Intronic
1028312544 7:89356787-89356809 GATGTGGTCTGCCCACATTAGGG + Intergenic
1028611547 7:92717578-92717600 GATGCTGGCTGAACAAATGTAGG + Intronic
1029074272 7:97923871-97923893 GATGCTGGTGACTCACATGACGG - Intergenic
1030363905 7:108624815-108624837 GATCCTGGCTCCCCAAAAGAGGG + Intergenic
1030533036 7:110733838-110733860 GATGCTGTATCCTCACATGATGG - Intronic
1031078907 7:117239799-117239821 GATGATGGCCACCCCCATGAGGG + Intergenic
1034056384 7:148039362-148039384 GATCATGCCTGCCCACATGAGGG + Intronic
1034294564 7:149960596-149960618 GATGGTGGCTTCCAAAATGACGG - Intergenic
1036013908 8:4759246-4759268 GATGATGACTGCCCTCAGGAAGG + Intronic
1036243435 8:7097417-7097439 GATGCTGGTGACTCACATGACGG + Intergenic
1036829290 8:12009774-12009796 GATGCTGGTGACTCACATGACGG - Intergenic
1036930192 8:12949315-12949337 GATGCTGGGTGTACACATGGGGG - Intronic
1037271437 8:17134785-17134807 GATGTGGCCTGCCCACATCAGGG + Intergenic
1037493521 8:19418021-19418043 GATCCTGGCTGCACAGGTGATGG - Intronic
1038572318 8:28673374-28673396 GATGATGCCTGCTCACATTAGGG - Intronic
1042357958 8:67850067-67850089 GATGATGCCCGCCCACATTAAGG + Intergenic
1044568911 8:93696620-93696642 GATGAGGCCTGCCCACATTAGGG - Intergenic
1044740174 8:95318375-95318397 GATGATAGCTGCCCACATTGGGG - Intergenic
1045681912 8:104670058-104670080 AGTGCTGTCTGCCCACATTATGG - Intronic
1046012798 8:108570917-108570939 GATGATGCCTGCCCACATTATGG + Intergenic
1046470243 8:114663004-114663026 GATGGTGCCTGTCCACATTAAGG + Intergenic
1047255486 8:123210501-123210523 CATGGTGGCTGTTCACATGAAGG - Intergenic
1049420520 8:142514355-142514377 GATGCGGGCTGCGCAGATGCCGG + Intronic
1051580372 9:18666710-18666732 GAGGCTTTCTGGCCACATGATGG - Intronic
1055392995 9:75843458-75843480 GATGGTGGCTGCCTACAAGCCGG + Intergenic
1057273750 9:93665422-93665444 GAAGCTATCTGCCCACAGGAGGG - Intronic
1057951860 9:99375593-99375615 GGTGCTGGGAGCCCACCTGATGG - Intergenic
1058148272 9:101435571-101435593 GATGGTGGCTGAAAACATGATGG - Intronic
1058148418 9:101437186-101437208 GATGGTGGCTGAAAACATGATGG - Intergenic
1187058568 X:15764006-15764028 GATGATACCTGCCCACATTAAGG + Intronic
1187410241 X:19044858-19044880 GATCCAGGCTTACCACATGAAGG + Intronic
1188015483 X:25103599-25103621 GATGGGGGCTGCCCACATCAAGG + Intergenic
1188284698 X:28313406-28313428 AATGCTGGCTGCTCACAATATGG + Intergenic
1190592385 X:52017756-52017778 GATGATGCCTGCCTACATTAGGG + Intergenic
1193531146 X:82656126-82656148 GATGGTGCCTGCCCACATTGAGG + Intergenic
1194575726 X:95612214-95612236 GATCCTGGCTCCCCAAATAAAGG + Intergenic
1195019741 X:100815003-100815025 GATGGTGCCTGCCCACATTGAGG + Intergenic
1196465564 X:115968818-115968840 GGCTCTGGCTGCTCACATGATGG + Intergenic
1198218337 X:134577329-134577351 GAGGCTGGCTGTCCACTTGTTGG + Intronic
1198783486 X:140261473-140261495 GATGGTGCCTGCCCAGATTATGG + Intergenic
1201426445 Y:13856727-13856749 GATACTGTCTGCCCACATGGAGG - Intergenic