ID: 1091274655

View in Genome Browser
Species Human (GRCh38)
Location 11:134342217-134342239
Sequence CTCTAGCTGGGTCACCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091274651_1091274655 -8 Left 1091274651 11:134342202-134342224 CCGTGGGGGACTCTGCTCTAGCT 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1091274655 11:134342217-134342239 CTCTAGCTGGGTCACCTCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1091274646_1091274655 7 Left 1091274646 11:134342187-134342209 CCTTCGACGGCCTTCCCGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1091274655 11:134342217-134342239 CTCTAGCTGGGTCACCTCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1091274649_1091274655 -3 Left 1091274649 11:134342197-134342219 CCTTCCCGTGGGGGACTCTGCTC 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1091274655 11:134342217-134342239 CTCTAGCTGGGTCACCTCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1091274643_1091274655 13 Left 1091274643 11:134342181-134342203 CCGGAGCCTTCGACGGCCTTCCC 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1091274655 11:134342217-134342239 CTCTAGCTGGGTCACCTCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1091274650_1091274655 -7 Left 1091274650 11:134342201-134342223 CCCGTGGGGGACTCTGCTCTAGC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1091274655 11:134342217-134342239 CTCTAGCTGGGTCACCTCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091274655 Original CRISPR CTCTAGCTGGGTCACCTCGT GGG Intronic
900962505 1:5934285-5934307 CTCTAACTGGGGCTCCTGGTCGG - Intronic
905166781 1:36087744-36087766 CTCTAGCTGGTGAACCTCGTCGG - Exonic
905177840 1:36149191-36149213 CTCTTGCTGGGTCACTCCGGGGG - Intronic
911094340 1:94043403-94043425 CTCCAGCTGGGCCTCCTCCTGGG + Exonic
914478066 1:148040550-148040572 CTTGAGCTGGGTCAGTTCGTGGG + Intergenic
915041055 1:152968615-152968637 CTCTATCTGGGTCACCCCTGGGG + Intergenic
921384685 1:214556817-214556839 CTCTACCTGGGCCAACTCCTAGG + Intergenic
1069929396 10:71872435-71872457 CTCTTGCTGGGTGACCTTGGGGG - Intergenic
1075951484 10:126481622-126481644 CACTAGCTGGGCCACCATGTTGG + Intronic
1090051173 11:123381149-123381171 CTCTTCCTGGGTCAGCTCTTGGG + Intergenic
1091274655 11:134342217-134342239 CTCTAGCTGGGTCACCTCGTGGG + Intronic
1101409633 12:104457679-104457701 ATCTACCCGGGTCACCGCGTCGG + Intronic
1103847183 12:123909612-123909634 CTCTCCCTGGGTCACGTCATGGG - Intronic
1105703996 13:22957646-22957668 CTGCAGCTGGGTCTCCTCGGTGG + Intergenic
1105856949 13:24382730-24382752 CTGCAGCTGGGTCTCCTCGGTGG + Intergenic
1119572896 14:75691844-75691866 GTCTCTCTGGGTCACCTAGTGGG + Intronic
1122845710 14:104496975-104496997 CTGCAGCTGGGTCTCCTCGGTGG + Intronic
1129833582 15:78686644-78686666 CCCTAGCAGGGTGACCTCGGAGG + Intronic
1132038470 15:98505496-98505518 CTCTAGCTGGGCCCCCTTCTAGG + Intronic
1134128157 16:11630422-11630444 CTCTGGCGGGGACACCTCTTGGG + Intronic
1138178679 16:54928702-54928724 CTCTAGTCGTGTCCCCTCGTGGG - Intergenic
1147570671 17:41568556-41568578 CCGGAGCTGGGTCACCTCCTTGG + Exonic
1148863899 17:50618809-50618831 CTCTAGCTCGGCCTCCTCCTTGG - Exonic
1149768307 17:59298860-59298882 TTCTTGCTGAGGCACCTCGTTGG + Intergenic
1151717736 17:75840018-75840040 CTCGTGCTGGGTGACCTCGTGGG + Exonic
1151745602 17:76010136-76010158 CTCCACCTGGGTGACCTCCTTGG + Exonic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1162578345 19:11512612-11512634 CTCTGGCTGAGTCCCCTGGTAGG - Intronic
1164408205 19:27973460-27973482 CTCCAGCTGTGTCATCTCATTGG - Intergenic
1165808378 19:38595967-38595989 CTCTACCTGGGTCACCTGCACGG + Exonic
1166009077 19:39927750-39927772 CTGTAGCTGGGCCACATTGTAGG + Exonic
926311247 2:11677674-11677696 CTCCAGCTGGGAGACCTCGCAGG + Exonic
934887567 2:98038334-98038356 CTCTAGCTGGCTTACTTCTTGGG - Intergenic
937551472 2:123097623-123097645 CTCTTGATGGGTCACCTCTCAGG + Intergenic
948424003 2:237876558-237876580 CTCTTTCTTGGCCACCTCGTAGG - Intronic
1172710778 20:36921601-36921623 GTCTAGCTCTGTCACCTCCTGGG + Intronic
1174396761 20:50251373-50251395 CTCTTGCTGGGGGACTTCGTAGG + Intergenic
1179719827 21:43308676-43308698 CTCTGGCTGGGTCTCCTTGGAGG + Intergenic
1181715036 22:24719530-24719552 CACAAGCTGGCTTACCTCGTGGG - Exonic
951380309 3:21976043-21976065 CTCTAACTGGGACACCTTGAGGG + Intronic
961688147 3:128650070-128650092 CTCTACTTGAGCCACCTCGTCGG + Intronic
967865027 3:194183071-194183093 CTCTAGCTAGGGCACCTGTTGGG - Intergenic
970833502 4:20371069-20371091 CTCTAGTTGGGTCACTTCTTGGG + Intronic
971757623 4:30722240-30722262 CACTCGCAGGGTCAGCTCGTAGG - Exonic
972175709 4:36402815-36402837 CTCCAGCAGGGTCCCATCGTAGG - Intergenic
982382794 4:154767252-154767274 CACTAGCTAGGGCACCTAGTGGG + Intergenic
986774579 5:11002201-11002223 TTCTGGATGGGTCACCTTGTGGG + Intronic
992025458 5:72665020-72665042 TTCTAGCTGGGATACCTCATAGG - Intergenic
998193073 5:140043191-140043213 CCCTAGCTGGGCCACCTCCCCGG - Exonic
999241387 5:150129905-150129927 CTCCAGCTGGCTCTCCTCTTCGG + Exonic
1001513606 5:172339761-172339783 CCGGAGCTGGGTCACCTCGTGGG + Exonic
1001974613 5:175987269-175987291 CTCTAGCTGGCACCCCTGGTTGG + Intronic
1002242821 5:177856510-177856532 CTCTAGCTGGCACCCCTGGTTGG - Intergenic
1003946839 6:11083852-11083874 CTGCAGCTAGCTCACCTCGTAGG + Intergenic
1007143010 6:39595360-39595382 CCCTAGCTGGGTAATCTTGTGGG + Intronic
1018199155 6:161379267-161379289 CTCTAGGTGGCTTACCTGGTGGG - Intronic
1020010336 7:4803141-4803163 CTCTGGCTGGGTCCCCTCCCCGG + Intronic
1021087449 7:16439158-16439180 CTATAGATGGGGCACCTCCTTGG + Intergenic
1024533596 7:50412131-50412153 ATCTAGTTGGGTCACATCTTTGG - Intergenic
1026098847 7:67368401-67368423 CTCTAGCTGGGTGGCCTCATTGG - Intergenic
1027614060 7:80399520-80399542 CTCTACGTGGCTCACCTCGTAGG - Intronic
1035031564 7:155864311-155864333 CTCTAAATGTGTCAACTCGTAGG - Intergenic
1037828940 8:22177046-22177068 CACGAGCTGGGCCACGTCGTCGG + Exonic
1039424713 8:37476497-37476519 CCCCAGCTGGGGCACCTGGTGGG + Intergenic
1040564764 8:48555654-48555676 CTCTAGCTGGGTCAGCAGGCAGG - Intergenic
1049401311 8:142428724-142428746 CTCAGGCTGAGTCACGTCGTGGG + Intergenic
1056814193 9:89789760-89789782 CTCCTGCTTTGTCACCTCGTGGG + Intergenic
1061821134 9:133227743-133227765 CTCTAGCTGAGGCACCTCACTGG + Intergenic
1061854928 9:133436830-133436852 CTCCAGCTGGGTCTTCTCGCAGG - Exonic
1198763203 X:140055870-140055892 CTGTAGCTGGGTCACCTTTAAGG - Intergenic