ID: 1091275011

View in Genome Browser
Species Human (GRCh38)
Location 11:134344188-134344210
Sequence TTGTTGATGCAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 346}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091275005_1091275011 13 Left 1091275005 11:134344152-134344174 CCTTTTACTCAGCCGGTCTTATG 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG 0: 1
1: 0
2: 4
3: 33
4: 346
1091275006_1091275011 1 Left 1091275006 11:134344164-134344186 CCGGTCTTATGCTTCATCCAAAT 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG 0: 1
1: 0
2: 4
3: 33
4: 346
1091275004_1091275011 18 Left 1091275004 11:134344147-134344169 CCTGACCTTTTACTCAGCCGGTC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG 0: 1
1: 0
2: 4
3: 33
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091275011 Original CRISPR TTGTTGATGCAGAGGGAAGA GGG Intronic
900420444 1:2553804-2553826 GTGCTGCTGCAGAGGGAAGCTGG - Intergenic
900423982 1:2567854-2567876 GTGCTGCTGCAGAGGGAAGCTGG + Intergenic
900545801 1:3228591-3228613 TTGTCGAGGCAGTGGGGAGAGGG - Intronic
900598142 1:3491714-3491736 TTGTCTCTGCAGAGGGAAGTGGG - Intronic
901674548 1:10875256-10875278 TTCTTGAGGCAGGAGGAAGAGGG - Intergenic
901674852 1:10877156-10877178 TTCTTGAGGCAGAAGGAGGAGGG + Intergenic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
902667028 1:17946680-17946702 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
903044430 1:20554362-20554384 TTTTTTTTGCACAGGGAAGAAGG - Exonic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903330095 1:22592900-22592922 TTCTGGATGCTGAGGGAAGGGGG - Intronic
903588483 1:24436454-24436476 TTCTGAATGCAGAGAGAAGAAGG - Intronic
904621402 1:31777460-31777482 GGGTGGATGCAGAGGTAAGAAGG - Intergenic
906787815 1:48631092-48631114 TTGTTGATTCTGTGGGCAGAAGG + Intronic
907366627 1:53966201-53966223 GTGTTTATGGAGAGGGAAAAAGG + Intronic
907541895 1:55223138-55223160 TTGTTGAAGCAGAGGTAAAACGG - Intergenic
908072459 1:60477174-60477196 TTGTTCATGGAGAGGCAATATGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910127071 1:83854645-83854667 TTGTGGATTCACAGGGATGAAGG - Intergenic
910683505 1:89891898-89891920 TTGTTAATACAGAGGGCAGGGGG - Intronic
911376250 1:97055805-97055827 TTGTTGCTGCAATGTGAAGAAGG + Intergenic
911830848 1:102549998-102550020 TGGTTGAAGCAGAGGAAACATGG + Intergenic
912115766 1:106405820-106405842 TTGTTGAGGCTGAAGAAAGATGG - Intergenic
913317039 1:117562236-117562258 TGGTTGATGCAGAGGTCACAGGG + Intergenic
913986561 1:143570903-143570925 TTGTGGATGCAGAGGAGAGGAGG + Intergenic
915758339 1:158285766-158285788 TGGCTGTTGCAGAGGGCAGAGGG + Intergenic
916979394 1:170116740-170116762 TGGATGATGCAGGGAGAAGAGGG - Intergenic
918124861 1:181574450-181574472 TTGTTGAAGCAGAGGTCAAAAGG - Intronic
919195414 1:194278661-194278683 TTGTAGGTGCAGAGGGTACATGG - Intergenic
919316366 1:195975624-195975646 TTGTTGAGACAGGGAGAAGAGGG - Intergenic
919644940 1:200086257-200086279 TTATTAATGGAGAGGTAAGAGGG + Intronic
919722943 1:200860159-200860181 TTATTAATGCAGAAGGAATATGG + Exonic
919925139 1:202188296-202188318 TTGGTGCTGGAGAGGGCAGAGGG - Intergenic
920536313 1:206738943-206738965 TTTTAGTGGCAGAGGGAAGAGGG - Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
1062913929 10:1233144-1233166 TTGCTGATGGAGAGGACAGAGGG + Intronic
1063457518 10:6194696-6194718 TTGTGGATTCAGTGGGAAGCTGG + Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066565935 10:36722137-36722159 TGGTTGAAACAGAGGGAAAATGG - Intergenic
1067082280 10:43218491-43218513 GTGCTGCTGCAGAGGGAACAAGG - Intronic
1067190609 10:44064719-44064741 TTGATGATGCAGATATAAGAAGG + Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070494144 10:77006101-77006123 TTGCTGATGCAGGTGGCAGATGG - Intronic
1070524455 10:77283229-77283251 TTATTGGTGCAGAAAGAAGAAGG - Intronic
1070920741 10:80184078-80184100 TTGTTGAAGCTGAGGGATGATGG - Intronic
1071461204 10:85897912-85897934 TTATAGAAGCAGAGAGAAGAAGG - Intronic
1071954027 10:90737258-90737280 GAGGTGATGCAGAGTGAAGAGGG - Intergenic
1073077633 10:100834698-100834720 TGGTTGAGGCAGAGGGTGGAAGG + Intergenic
1073560208 10:104489775-104489797 TTGTTGACACAGAGGAAGGAGGG + Intergenic
1074156403 10:110804061-110804083 TTGTTGAAGGAAAGGGAAGGGGG - Intronic
1074230222 10:111526322-111526344 ATTCTGATGCAGAGGGTAGAAGG + Intergenic
1075237283 10:120742367-120742389 GTGATGTTGCAGAGGTAAGATGG - Intergenic
1075909014 10:126107416-126107438 TTATTGATGCAGAGTGCATAAGG + Intronic
1076758707 10:132589344-132589366 TTCTTGAGGCAAAGGGAAGGTGG + Intronic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1078457574 11:11487069-11487091 TTATGGATGCAAAGGAAAGAAGG - Intronic
1078527596 11:12111945-12111967 TTCTTCATGCAGAGAGAAGACGG + Intronic
1078541559 11:12217508-12217530 TCTGTGAGGCAGAGGGAAGAAGG - Intronic
1078665853 11:13324533-13324555 TGGTTGAAGCAGCGGGGAGAGGG - Intronic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1083238649 11:61369280-61369302 TACTTGACCCAGAGGGAAGATGG + Exonic
1083543702 11:63533486-63533508 TGGGTGATGGAGAGGGGAGAGGG - Intergenic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1085410346 11:76287160-76287182 TTGTGGAGGCCGAGGCAAGAAGG - Intergenic
1086751039 11:90493798-90493820 TTGTTGATCAAGGGGGATGAAGG + Intergenic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1087564702 11:99839462-99839484 AAGTTGAGGCAGAGGGAAGGAGG + Intronic
1088540760 11:110911273-110911295 CTGCTGGTGCAGAGGGGAGAGGG + Intergenic
1089162900 11:116453072-116453094 TTATTGATGCAGTGGGAAAGAGG + Intergenic
1090153715 11:124413938-124413960 TGGTTTCTGCAGTGGGAAGATGG - Intergenic
1090377166 11:126298948-126298970 CCGTTGTTCCAGAGGGAAGAAGG - Intronic
1090642439 11:128740961-128740983 TTGTTAACCCAGAGGGAAAAAGG + Intronic
1090648856 11:128789110-128789132 ATGTTGAAGCAAAGGGAAGGAGG + Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1093152011 12:15632995-15633017 TGGTAGATGCTGAGGGAAGAAGG + Intronic
1094382304 12:29856093-29856115 TTGTTGATGGAGAGGGCGAAGGG + Intergenic
1095550647 12:43434896-43434918 TTCTGGAGGCAGAGGGAAAAAGG - Intronic
1095839867 12:46681500-46681522 TAATTAATGCAGAAGGAAGATGG - Intergenic
1097331593 12:58337680-58337702 TTGTTGATGCCATGTGAAGAAGG + Intergenic
1098217096 12:68232349-68232371 TTATTAATCCAGAGGCAAGATGG - Intergenic
1099004727 12:77222654-77222676 TTGTTGAGGCAGAAGGAAACAGG - Intergenic
1099418815 12:82426875-82426897 GTGTTGTGGTAGAGGGAAGATGG - Intronic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1100527241 12:95431356-95431378 TTGTGGAGACAGAGTGAAGAGGG + Intergenic
1101577013 12:106007057-106007079 TGGGGGATGCAAAGGGAAGAGGG - Intergenic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103856518 12:123973716-123973738 TTGTTGGAGCCGAGGGAAGGGGG + Exonic
1104084488 12:125461494-125461516 TAGTTGCTGCAGAGGGATGTGGG + Intronic
1104503404 12:129307724-129307746 GTCTTGGTGCAGAGAGAAGAGGG - Intronic
1105280964 13:18962390-18962412 TTCTTGATGTGGAGGGAAGGAGG - Intergenic
1105646282 13:22321350-22321372 TCCTTGATGCAGAGCAAAGATGG + Intergenic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1107355562 13:39561828-39561850 TTGTTGAATCAGAGTGAATATGG + Intronic
1108039339 13:46324729-46324751 TTGTTACTGGAGAGGGAAGCAGG - Intergenic
1108292066 13:48971921-48971943 TTGGTGATGAAGAGGAGAGATGG - Intergenic
1108376671 13:49820453-49820475 TTGTAGATGGAAAGTGAAGAAGG + Intergenic
1108379403 13:49841880-49841902 ATGTGGATGCAGATGGAAGCAGG + Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1109004992 13:56862350-56862372 CAGATGATGCAGAGGGAAGGAGG - Intergenic
1110107352 13:71694070-71694092 TTATGAATGCAGAGGCAAGATGG + Intronic
1110709326 13:78632746-78632768 TTGGTGATGCAGAGTAAACAAGG + Intronic
1111957667 13:94776119-94776141 TAGATGCTGCTGAGGGAAGAAGG + Intergenic
1112299519 13:98217423-98217445 TAGTTGCTGCAGAGGGAACTCGG + Intronic
1113509467 13:110841489-110841511 TAGAAGCTGCAGAGGGAAGATGG - Intergenic
1113971294 13:114192320-114192342 GTGTGGATGCAGAGGGTATATGG + Intergenic
1114244008 14:20895589-20895611 GTGGTGATGGAGAGGGCAGAGGG - Intergenic
1114247069 14:20924170-20924192 GTGGTGATGGAGAGGGCAGAGGG - Intergenic
1114251752 14:20967884-20967906 TGGTTGATGAAGGTGGAAGAAGG + Intergenic
1114538625 14:23438627-23438649 TTGTTTGTGCACAGGGCAGAGGG + Intergenic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116605442 14:46987475-46987497 TCCTTTATGCAGAGGGCAGAAGG + Intronic
1117478662 14:56120644-56120666 TTGCTGATGCAGTGAGAACAGGG + Intronic
1118069322 14:62228542-62228564 TTGATTTTGCAGATGGAAGAAGG - Intergenic
1119191714 14:72687552-72687574 TAGGGGATGCAGAGGAAAGATGG - Intronic
1119584880 14:75823872-75823894 TTGTTGAATAAGAGGGCAGAAGG - Intronic
1119661152 14:76452696-76452718 TTGTGGATGCTAAGGGAAGGAGG + Intronic
1119851930 14:77872486-77872508 TTCTTGAAGAAGAGGGAAGTGGG + Intronic
1121529084 14:94640119-94640141 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
1121574463 14:94972197-94972219 GTGAGAATGCAGAGGGAAGAAGG + Intergenic
1121595912 14:95162025-95162047 TTGTTGAGGGTGAGGGAATAGGG + Intergenic
1121679990 14:95785818-95785840 TTGTGGATACCGAGGGATGACGG + Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122355870 14:101122551-101122573 TTGTTGGTTCAGAGCGAAGTGGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1123949315 15:25255142-25255164 TTGTTGCTCCATAGGTAAGATGG - Intergenic
1124477593 15:30048228-30048250 TTGTTCATGCAAAGGCAAGTTGG - Intergenic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1125207242 15:37167601-37167623 TTGCTGCAGGAGAGGGAAGATGG - Intergenic
1125492678 15:40159963-40159985 CTGATGATTCAGAGGAAAGAAGG + Intergenic
1126524018 15:49630178-49630200 TTGTTGATGGTGAGAGGAGAAGG + Intronic
1127372690 15:58355751-58355773 ATGTTGAGTCAGAGGGATGATGG - Intronic
1127664654 15:61133834-61133856 CTGATGATGCAGTAGGAAGAAGG - Intronic
1127933087 15:63610538-63610560 TTGTTGCTTCAGAGAGAAGTAGG - Intronic
1128230446 15:66031057-66031079 TTGTCCAAGCAGAGGGAAGTGGG + Intronic
1128243005 15:66114264-66114286 TTGCTGTGGCAGAGAGAAGAGGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130078512 15:80710623-80710645 TTGCTGATGCAGAGTGGTGAAGG + Intronic
1130890365 15:88128352-88128374 TTGTTCTTGCAGAGAGAATATGG - Intronic
1131031862 15:89193124-89193146 TTTTTGAAGCAAAGGGAAGAGGG - Intronic
1131098110 15:89668726-89668748 TTATTGATGCAGGGGACAGAGGG + Intronic
1131539342 15:93263117-93263139 TTGTTGTTGCAATGGAAAGAGGG - Intergenic
1134508263 16:14824977-14824999 TTCTTGTTGCAGGGGGAAGAGGG - Intronic
1134695962 16:16223742-16223764 TTCTTGTTGCAGGGGGAAGAGGG - Intergenic
1134975864 16:18570946-18570968 TTCTTGTTGCAGGGGGAAGAGGG + Intergenic
1135054328 16:19218483-19218505 TTGTATCTGCAAAGGGAAGAAGG + Intronic
1136118618 16:28113045-28113067 TTGGACCTGCAGAGGGAAGAGGG + Exonic
1141327501 16:83075500-83075522 TTGTGGATGCAAAGGGAACAGGG + Intronic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146469111 17:33110394-33110416 TTCCAGATGCAGAGGGACGAAGG - Intronic
1146833636 17:36091946-36091968 TTGTGGGTTCAGAGGAAAGAGGG + Intergenic
1147302794 17:39543247-39543269 TTGATGAGGCAGAAGGAAGGTGG + Intronic
1147338719 17:39741453-39741475 TGAGTGATGCAGAGGGGAGAAGG - Intronic
1147439148 17:40436817-40436839 TTGTTGAGTCAGAGGGCAGGTGG - Intergenic
1148982748 17:51593008-51593030 TTGATGATGGGGAGGGGAGAAGG + Intergenic
1149671515 17:58416964-58416986 TTGCTGAGGCAGAGGGAGGGGGG + Exonic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1153292922 18:3519469-3519491 TTGTTGAAGATGAGGGAATAGGG - Intronic
1157188652 18:45561684-45561706 TTGTTGCTGGAGAGGGAGGGAGG - Intronic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158780395 18:60642055-60642077 TGTTTGATGCAGAGGTAAGGAGG + Intergenic
1159867166 18:73719834-73719856 GAGTTGGTGCAGGGGGAAGAAGG - Intergenic
1159869957 18:73750075-73750097 TTGTTGATGAAAACGGAGGAAGG + Intergenic
1161422481 19:4183509-4183531 TGGGTGATGCAGAGGGCACAGGG + Intronic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163785659 19:19273578-19273600 TTGTGGAGGCAGGGGAAAGAGGG - Intergenic
1167145117 19:47676615-47676637 CTGATGATGAAGAGGGAAGGCGG - Intronic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
926638727 2:15212253-15212275 CTGTTCATGCAGAGGCCAGAGGG + Intronic
927126502 2:20016600-20016622 TTTTTGATCCACAGTGAAGAAGG + Intergenic
927814589 2:26203478-26203500 TTATTAATTCAGAGGTAAGATGG + Intronic
927991130 2:27447921-27447943 TTCTAGAGGTAGAGGGAAGAAGG + Exonic
928208416 2:29304610-29304632 ATGTTGATGCAAAGGGCAGGTGG - Intronic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
929780466 2:44953850-44953872 TAATTGATTCTGAGGGAAGAGGG + Intergenic
930542555 2:52725027-52725049 GTGTTGAAGCAGAGAGAAGGAGG - Intergenic
932071777 2:68627862-68627884 TTGTTTTTGCAGATGAAAGATGG - Intronic
932097532 2:68864852-68864874 TTGCTGCTGCAGAGAGTAGAGGG - Intergenic
932589001 2:73051830-73051852 TTGTTGTCTCACAGGGAAGAAGG + Intronic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933360500 2:81276784-81276806 TTGCTGGGGCAGAGGGAAGCAGG + Intergenic
933595091 2:84275317-84275339 GTCTTGATGCAGATGGAAGAGGG - Intergenic
934039223 2:88114284-88114306 TTGATGGTGCAGTGGGCAGATGG - Intergenic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
934813485 2:97304530-97304552 ATGTTCATGCAGAGGGAATGAGG + Intergenic
934824211 2:97403950-97403972 ATGTTCATGCAGAGGGAATGAGG - Intergenic
934985641 2:98882895-98882917 TTGTGGATTCACAGGGTAGAGGG + Intronic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
936274708 2:111084551-111084573 ATGTTGCTTCAGAGAGAAGATGG - Intronic
936517767 2:113193031-113193053 TCATTGCTGCAGAGGGAAAAGGG - Exonic
939442030 2:142261784-142261806 TTGTTGATGTGTAAGGAAGAAGG + Intergenic
939607652 2:144272441-144272463 TTGTTGCTGCTTAGGGAATATGG - Intronic
939979006 2:148756497-148756519 TAGTTGATGCAAAGGGTAAAAGG + Intronic
940058804 2:149542001-149542023 GTGTTGCTGCAGAGGTGAGAAGG - Intergenic
940448609 2:153809872-153809894 TTGTTGATACAGAGAAAATAGGG - Intergenic
940962656 2:159802203-159802225 TTGATGATGCAGTGGGGAGAGGG - Intronic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
944116564 2:196193216-196193238 TTGTTATTGAAGGGGGAAGAGGG - Intergenic
944517623 2:200527994-200528016 GAGTTGATACAAAGGGAAGAAGG + Intronic
945839433 2:214869932-214869954 TTGTTGATGCAGAGGTATAAAGG + Intergenic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
947490413 2:230589936-230589958 GTGTTTATGCAAAGGAAAGAGGG + Intergenic
947581254 2:231320272-231320294 TTGCTGATGCAGGGGGATGAGGG + Intronic
947944923 2:234093191-234093213 ATGCTGAGGCAGAGGAAAGAAGG + Intergenic
1169511675 20:6271024-6271046 TTGTTGAGCCAGTGGGAAGCTGG + Intergenic
1169571844 20:6914767-6914789 TTGTTGCTGGAGAAGGAAGAGGG + Intergenic
1169938977 20:10916598-10916620 TGGTGAATGCAGAAGGAAGAAGG - Intergenic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1172230500 20:33332860-33332882 TCGCTGATGGAGAGGGAGGAAGG + Intergenic
1172896285 20:38302634-38302656 TAGTTGCTGCAGATGGAAGCAGG + Intronic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173581768 20:44152030-44152052 TTGGTGGTGGAGAGGGAGGAAGG - Intronic
1174465228 20:50712138-50712160 TTCTTGATGAAGAGGGAGGTGGG + Intergenic
1174524344 20:51159320-51159342 TTGTTGATGCAGAAATGAGAAGG + Intergenic
1174628764 20:51938161-51938183 TTGTCTCTGAAGAGGGAAGATGG - Intergenic
1175617270 20:60411337-60411359 GTGTGGATGCAGAGAGGAGATGG - Intergenic
1178362640 21:31962067-31962089 TGGTTCATGCAGAGGGAGAAAGG + Intronic
1178684410 21:34700040-34700062 TTGATAAAGCAAAGGGAAGATGG + Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182852653 22:33489258-33489280 TCGTGGAGGGAGAGGGAAGAGGG + Intronic
1183169485 22:36175826-36175848 TCGTTGATGCACAAGGCAGATGG - Intergenic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
1183658436 22:39204499-39204521 TTCTAGATGGCGAGGGAAGAGGG + Intergenic
1183751138 22:39721268-39721290 CTGTTGGTGCAGAGCCAAGAGGG + Intergenic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1184445436 22:44544408-44544430 CTGATGATGCAGAGGTAAGAGGG - Intergenic
1184474783 22:44714577-44714599 TTGTGGATGCTGGGGGCAGAGGG - Exonic
951737422 3:25883401-25883423 ATGTTGATCCAGATGGCAGAAGG + Intergenic
952591842 3:34964598-34964620 TTGTTGATGCTGTGCGAGGATGG + Intergenic
952769966 3:36990669-36990691 TGGGTGATGGGGAGGGAAGAGGG + Exonic
953411972 3:42695749-42695771 GTGTGGATGCAGAGGAAAGCAGG - Intronic
954304117 3:49716594-49716616 GTTTTGAGGCAGAGGGAAGGTGG + Intronic
955193894 3:56787223-56787245 ATGTTGGGGCAGAGGGAAGGAGG - Intronic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956651582 3:71509347-71509369 GTGATGACACAGAGGGAAGATGG - Intronic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
960520737 3:118652066-118652088 TTGTCAAAGCAGAGGGAAAAGGG + Intergenic
960925483 3:122791889-122791911 TTTTTGCTGCAGAGTGGAGAAGG + Intronic
961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG + Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
962228029 3:133632714-133632736 TTGATGATGCAGATGAGAGAAGG - Intronic
962616925 3:137135590-137135612 TTTTTGATGCAGGGGGTGGATGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964422120 3:156514135-156514157 TTGTTGCTGCAAATGGAAAATGG + Intronic
967674561 3:192281194-192281216 TAGAGGATTCAGAGGGAAGATGG - Intronic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
969547220 4:7838417-7838439 TTGTTCAAGCATAGGCAAGATGG - Intronic
969851992 4:9964822-9964844 TTGTTGATGGAGAGGCAAGAGGG - Intronic
970022826 4:11588248-11588270 ATTTTGCTGCAAAGGGAAGAGGG - Intergenic
970334059 4:15014836-15014858 TAGTGGAAGCACAGGGAAGATGG + Intronic
970740958 4:19237101-19237123 TTGTTGCTGGAGAAGGGAGAAGG - Intergenic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
972770620 4:42193877-42193899 TGGGTAAAGCAGAGGGAAGATGG + Intergenic
975398950 4:73911834-73911856 TTGTTGATTCAGGGGGTACAGGG - Intergenic
975846205 4:78527870-78527892 TTGATGATGCAGGGGATAGAGGG + Intronic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
977791358 4:101107531-101107553 CTGGTGATGATGAGGGAAGAAGG - Intronic
977922190 4:102658033-102658055 TGGTTGTTGAATAGGGAAGAAGG - Intronic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978073054 4:104494718-104494740 TTCTTGTTGCAGAGAGAAGGAGG + Exonic
978753428 4:112278025-112278047 TTTCTGATGGAGAAGGAAGATGG - Exonic
979392754 4:120146003-120146025 ATGTTGGGGCAGTGGGAAGAAGG - Intergenic
982118841 4:152119743-152119765 TTGATGATGAAGAGGCACGAGGG - Intergenic
982592483 4:157332400-157332422 TTGTCAATGCAGAAGGAATATGG - Intronic
983907576 4:173199919-173199941 TTGTTGATTCAAAAGGAACATGG - Intronic
986057484 5:4153116-4153138 TTGATGATGGTGAGGCAAGAAGG + Intergenic
987123172 5:14786949-14786971 TGGTTCATCCAGAGGGCAGAAGG + Intronic
987950062 5:24663166-24663188 TTTTGGAGGCAGAGGGAAGGAGG - Intergenic
988080715 5:26411095-26411117 TTGTTAAAGCAGTTGGAAGAGGG + Intergenic
988969832 5:36456327-36456349 TTCTTCATGCAGAGGGGATAAGG + Intergenic
989019570 5:36986815-36986837 TTGTTTATGCAAAGGTAATAGGG + Intronic
990733453 5:58834387-58834409 TTGTTTTTGCAGGGGTAAGAGGG - Intronic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
993086694 5:83371741-83371763 TTGTTGATGCAGGAAGGAGAAGG + Intergenic
993204830 5:84865113-84865135 CTGGTGATGGAGAGGGGAGAGGG - Intergenic
993223289 5:85131936-85131958 ATGCAGATGCAGGGGGAAGAAGG - Intergenic
993518504 5:88867819-88867841 ATGTCGATGCAGATGGAAAAAGG + Intronic
994108738 5:95976262-95976284 TTGTTGATACTTAGGTAAGATGG + Intergenic
996182894 5:120441797-120441819 TTGTTGAGACAGAAGGAAGTAGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
997263005 5:132478077-132478099 TTGTGGATGCTGAGGGAAGGCGG - Intergenic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
999319704 5:150606276-150606298 TTGTTGGGGCAGAGGGGAGCAGG - Intronic
999589569 5:153130360-153130382 TTGGTGAGGAAAAGGGAAGATGG - Intergenic
1000128695 5:158273655-158273677 TTTTTGAGGGTGAGGGAAGAGGG + Intergenic
1000312591 5:160059611-160059633 TTGTTGTGGCTTAGGGAAGAGGG + Intronic
1000507037 5:162133899-162133921 TTGTTGAGGCAGAGGCAGGCTGG + Intronic
1000770504 5:165347440-165347462 TTCTTGACAGAGAGGGAAGAGGG - Intergenic
1002619144 5:180474691-180474713 TTGCTGCTGCTGAGGGCAGATGG - Intergenic
1002624038 5:180511946-180511968 CTTTTGATGGAAAGGGAAGAAGG - Intronic
1002850909 6:995645-995667 TTGAGGATGGAGAGGGAAGGAGG - Intergenic
1003169336 6:3708808-3708830 TTGTTCATGCAGTGTGAGGAAGG + Intergenic
1003447239 6:6195788-6195810 TTGTTTTTGCAGAGGTAAGCAGG - Exonic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1007266346 6:40599211-40599233 AACTTGATGGAGAGGGAAGAAGG - Intergenic
1007688891 6:43685061-43685083 TTACTGGTGGAGAGGGAAGAGGG + Intronic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1007835128 6:44668145-44668167 TTATGGAGGCAGAGGAAAGAAGG - Intergenic
1008264051 6:49401974-49401996 TTGTTGATGTAGAGGACAGCAGG - Intergenic
1008838713 6:55870348-55870370 TTGTTGAAGAAGAGAGAAAAAGG + Intronic
1010114195 6:72282300-72282322 TTCCTGAAGCACAGGGAAGAAGG - Intronic
1010828905 6:80507349-80507371 TTGTTGATGCCTAGGGAGGAAGG + Intergenic
1011031555 6:82929793-82929815 GTGTGGATACAGAGGGAATATGG - Intronic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011260439 6:85464832-85464854 ATGGTGAGGGAGAGGGAAGAGGG + Intronic
1012398502 6:98825573-98825595 TTGCTGATGGAGAGGGAGCAGGG - Intergenic
1012949352 6:105501617-105501639 TGGTTGCTGGAGAGAGAAGAAGG + Intergenic
1012995274 6:105966685-105966707 CTGATGATGAAGTGGGAAGATGG - Intergenic
1013310117 6:108885946-108885968 TTCTTGCTGCAGTGTGAAGATGG - Intronic
1013420103 6:109959705-109959727 TTGATGCTGAAGAGGCAAGAAGG - Intergenic
1014792260 6:125686758-125686780 TTGGGGATTCAGGGGGAAGAGGG - Intergenic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1020140226 7:5607736-5607758 TGGCTGCTGCAGAGGGAAGTCGG + Intergenic
1021295909 7:18905799-18905821 TTGATGAGGGAGAAGGAAGAAGG - Intronic
1021587365 7:22223581-22223603 TTGATGATGCAGGAGGGAGAAGG + Intronic
1026019586 7:66697071-66697093 TGGTTGACACAGAGGGAAGATGG - Intronic
1026124689 7:67569273-67569295 TTGTGGATGCACTTGGAAGAGGG - Intergenic
1026880799 7:73905509-73905531 TGGTCGATACAGAGGGAAGGAGG + Intergenic
1028048120 7:86149485-86149507 TTACAGATCCAGAGGGAAGAGGG - Intergenic
1028661542 7:93283042-93283064 TTGATGATCCAGAGAGAAAATGG - Intronic
1029191613 7:98776078-98776100 TGTTTGATGAAGGGGGAAGAGGG + Intergenic
1029504644 7:100955491-100955513 TTCTGGATGCTGGGGGAAGATGG - Exonic
1031460964 7:122047984-122048006 TAATAGATGCAGAGGGAAAAGGG + Intronic
1034981533 7:155481342-155481364 TTGTTGATGCAGGATGATGATGG + Intronic
1037689814 8:21172364-21172386 TAGTTCATGCAAGGGGAAGACGG - Intergenic
1039842205 8:41302277-41302299 TTGTGGATGAAGATGGAAGCTGG - Intronic
1039907075 8:41794483-41794505 TTATTGAGGGAGAGGGAAGCGGG - Intronic
1044384271 8:91568687-91568709 CGATTGATGCAGATGGAAGAGGG - Intergenic
1046699742 8:117386768-117386790 TTGTTGATCCAAAGGGAAGATGG - Intergenic
1047631015 8:126708583-126708605 TTGGGGATTGAGAGGGAAGATGG - Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048164355 8:132049083-132049105 TTGTTAATGAAGAGGGGAAAGGG + Intronic
1048795152 8:138142971-138142993 TAGTTAATGCTGGGGGAAGAGGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048909699 8:139123301-139123323 TAATTGATGGAAAGGGAAGATGG + Intergenic
1049609900 8:143550069-143550091 TTGCGGACCCAGAGGGAAGAAGG - Intergenic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1049910451 9:261119-261141 TTGTCTATGCAGAGGGAACTGGG + Intronic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1050858827 9:10397447-10397469 TTGTTTTTGGAGAGGGAACAAGG + Intronic
1050907406 9:11022603-11022625 TTGTTGATGCAGATAGAAAGTGG + Intergenic
1051103112 9:13545550-13545572 TTGTTGTTGCAGGGGGAGGGTGG + Intergenic
1051389537 9:16549110-16549132 TTTTGGATGTAGGGGGAAGAGGG - Intronic
1051577422 9:18632906-18632928 TTGTTGAGGAAGAGGGTATATGG - Intronic
1052145878 9:25048512-25048534 TTGATTATGGAGTGGGAAGAAGG - Intergenic
1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG + Intronic
1053377587 9:37621060-37621082 AAATTGATGGAGAGGGAAGAAGG + Intronic
1056480213 9:86995774-86995796 TTATTTATACAGAGGGAGGAGGG - Intergenic
1057176597 9:93004748-93004770 CTCCTGATGCAGAGGGAAGCCGG - Intronic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1058948405 9:109880386-109880408 GTGTTGATCTAGAGGGAAGTAGG + Intronic
1059947122 9:119420823-119420845 TAATTGATGCAGAGGAAGGAAGG + Intergenic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1060899478 9:127245046-127245068 TTAGTGATAAAGAGGGAAGACGG - Intronic
1061277714 9:129579026-129579048 TTGTTGGGGGAGAGGGAGGATGG - Intergenic
1062195614 9:135272306-135272328 TTGTTGTTTCATAGGTAAGACGG - Intergenic
1062218270 9:135400682-135400704 TTGTGGATGCAAAGGGAGGCCGG + Intergenic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1187346985 X:18474438-18474460 TTGTTGAGGATGAGGGAAAATGG - Intronic
1187619919 X:21040717-21040739 TTGATGCTGCAGAGAAAAGAGGG - Intergenic
1187661913 X:21556930-21556952 TTGATGATGCAGGAGAAAGAAGG + Intronic
1188260563 X:28017831-28017853 TTGGTGATGCCAAGGTAAGAAGG + Intergenic
1188267012 X:28089398-28089420 AAGATGATGCAGAGAGAAGATGG - Intergenic
1189289757 X:39876822-39876844 CTGTTGATGCAGAGAGAAGCAGG + Intergenic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190578639 X:51868736-51868758 ATGTTGATGTAGAGGGAGGTTGG + Intronic
1190773777 X:53536500-53536522 TTGGGGTTGCAGTGGGAAGATGG + Exonic
1192822892 X:74662993-74663015 TTGTTGATACAAATGTAAGATGG - Intergenic
1194119582 X:89944122-89944144 TTGTTAATGCAATGGAAAGATGG - Intergenic
1194297563 X:92144765-92144787 AAATTGATGCAGAGGGATGAAGG + Intronic
1195791229 X:108589143-108589165 GTGTAGATGCAGAGAGAATAAGG + Intronic
1197824677 X:130576071-130576093 GTGTAGATGCAGCGGGAAGAAGG - Intergenic
1199974902 X:152888505-152888527 TTGTTGATGTAAAGGGAAGAAGG + Intergenic
1200472450 Y:3601654-3601676 TTGTTAATGCAATGGAAAGATGG - Intergenic
1200615137 Y:5369666-5369688 AAATTGATGCAGAGGGATGAAGG + Intronic